Transcript: Mouse NM_009906.6

Mus musculus tripeptidyl peptidase I (Tpp1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tpp1 (12751)
Length:
3573
CDS:
49..1737

Additional Resources:

NCBI RefSeq record:
NM_009906.6
NBCI Gene record:
Tpp1 (12751)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009906.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222486 CAGATGAAGTAGTTGACTATA pLKO.1 1244 CDS 100% 13.200 18.480 N Tpp1 n/a
2 TRCN0000222487 CCTACAAAGACCCATGTTATA pLKO.1 481 CDS 100% 13.200 18.480 N Tpp1 n/a
3 TRCN0000222484 GCTGAGTTTCATCGCTATGTA pLKO.1 454 CDS 100% 5.625 7.875 N Tpp1 n/a
4 TRCN0000222483 CCTTGATAAATGAGCACAGAA pLKO.1 1502 CDS 100% 4.950 3.960 N Tpp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009906.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06012 pDONR223 100% 86.2% 88.2% None (many diffs) n/a
2 ccsbBroad304_06012 pLX_304 0% 86.2% 88.2% V5 (many diffs) n/a
3 TRCN0000470587 GCCAACCATGCCTCGCACACACCA pLX_317 26.3% 86.2% 88.2% V5 (many diffs) n/a
Download CSV