Transcript: Mouse NM_009911.3

Mus musculus chemokine (C-X-C motif) receptor 4 (Cxcr4), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Cxcr4 (12767)
Length:
1821
CDS:
91..1170

Additional Resources:

NCBI RefSeq record:
NM_009911.3
NBCI Gene record:
Cxcr4 (12767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028724 ACTTCTGATAACTACTCTGAA pLKO.1 118 CDS 100% 4.950 6.930 N Cxcr4 n/a
2 TRCN0000226010 GTTTCAATTCCAGCATATAAT pLKO_005 705 CDS 100% 15.000 12.000 N Cxcr4 n/a
3 TRCN0000028750 CAAGATCCTTTCCAAAGGAAA pLKO.1 1089 CDS 100% 0.495 0.396 N Cxcr4 n/a
4 TRCN0000244575 CACTTATGCAAAGACATATAT pLKO_005 1171 CDS 100% 15.000 10.500 N Cxcr4 n/a
5 TRCN0000226011 GCCTGCTGGCTGCCATATTAT pLKO_005 859 CDS 100% 15.000 10.500 N Cxcr4 n/a
6 TRCN0000028749 GTGTTTCAATTCCAGCATATA pLKO.1 703 CDS 100% 13.200 9.240 N Cxcr4 n/a
7 TRCN0000218703 CTATACCTGACTTCATCTTTG pLKO_005 599 CDS 100% 10.800 7.560 N Cxcr4 n/a
8 TRCN0000226009 GTACATCTGTGACCGCCTTTA pLKO_005 660 CDS 100% 10.800 7.560 N Cxcr4 n/a
9 TRCN0000028678 CCTGACTATACCTGACTTCAT pLKO.1 594 CDS 100% 4.950 3.465 N Cxcr4 n/a
10 TRCN0000028704 CCATATCATCTACACTGTCAA pLKO.1 432 CDS 100% 4.950 2.970 N Cxcr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01835 pDONR223 100% 85.1% 89.1% None (many diffs) n/a
2 ccsbBroad304_01835 pLX_304 0% 85.1% 89.1% V5 (many diffs) n/a
3 TRCN0000480118 TATGTTGGAGTTCGACTACACTAG pLX_317 31.3% 85.1% 89.1% V5 (many diffs) n/a
4 TRCN0000491334 AGGCGCCGAGAGCAATCGATATGT pLX_317 25.2% 85.1% 89.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488789 CTTACGCTACCTCCATTTCTGGAC pLX_317 29.9% 85% 88.8% V5 (many diffs) n/a
Download CSV