Transcript: Mouse NM_009981.4

Mus musculus phosphate cytidylyltransferase 1, choline, alpha isoform (Pcyt1a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pcyt1a (13026)
Length:
4787
CDS:
122..1225

Additional Resources:

NCBI RefSeq record:
NM_009981.4
NBCI Gene record:
Pcyt1a (13026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009981.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306333 GGCAGAGCACCGGATTGATTT pLKO_005 595 CDS 100% 13.200 18.480 N Pcyt1a n/a
2 TRCN0000337580 CCCTATGTCAGGGTGACTATG pLKO_005 293 CDS 100% 10.800 15.120 N Pcyt1a n/a
3 TRCN0000111504 GCGATGATGTGTATAAGCACA pLKO.1 654 CDS 100% 2.640 3.696 N Pcyt1a n/a
4 TRCN0000306332 TTTCCCTAATACGTATCTAAT pLKO_005 427 CDS 100% 13.200 10.560 N Pcyt1a n/a
5 TRCN0000306331 TACTGTTTATGCTCATGTAAT pLKO_005 1473 3UTR 100% 13.200 9.240 N Pcyt1a n/a
6 TRCN0000337579 TGTAATCTTGACAGGGAAATT pLKO_005 1488 3UTR 100% 13.200 9.240 N Pcyt1a n/a
7 TRCN0000111500 CCTAAGGACATCTACAAAGAA pLKO.1 1313 3UTR 100% 5.625 3.938 N Pcyt1a n/a
8 TRCN0000111501 CCCGAGAGTTCATTGGAAGTT pLKO.1 966 CDS 100% 4.950 3.465 N Pcyt1a n/a
9 TRCN0000326603 CCCGAGAGTTCATTGGAAGTT pLKO_005 966 CDS 100% 4.950 3.465 N Pcyt1a n/a
10 TRCN0000111503 GTTGACTTTAGTAAGCCCTAT pLKO.1 278 CDS 100% 4.050 2.835 N Pcyt1a n/a
11 TRCN0000111502 CCTGTGAGAGTTTATGCGGAT pLKO.1 347 CDS 100% 2.160 1.512 N Pcyt1a n/a
12 TRCN0000326536 CCTGTGAGAGTTTATGCGGAT pLKO_005 347 CDS 100% 2.160 1.512 N Pcyt1a n/a
13 TRCN0000337517 TCACTGTGATGAACGAGAATG pLKO_005 492 CDS 100% 10.800 6.480 N Pcyt1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009981.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01157 pDONR223 100% 89.7% 96.1% None (many diffs) n/a
2 ccsbBroad304_01157 pLX_304 0% 89.7% 96.1% V5 (many diffs) n/a
3 TRCN0000476805 TCTCCTGTATCATCGGCTATGTAT pLX_317 26% 89.7% 96.1% V5 (many diffs) n/a
Download CSV