Transcript: Mouse NM_010185.4

Mus musculus Fc receptor, IgE, high affinity I, gamma polypeptide (Fcer1g), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Fcer1g (14127)
Length:
683
CDS:
105..365

Additional Resources:

NCBI RefSeq record:
NM_010185.4
NBCI Gene record:
Fcer1g (14127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010185.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067588 CCTACTCTACTGTCGACTCAA pLKO.1 224 CDS 100% 4.950 6.930 N Fcer1g n/a
2 TRCN0000067591 CAGGTCCGAAAGGCAGCTATA pLKO.1 249 CDS 100% 10.800 7.560 N Fcer1g n/a
3 TRCN0000057457 GAGACTCTGAAGCATGAGAAA pLKO.1 333 CDS 100% 4.950 3.465 N FCER1G n/a
4 TRCN0000067590 TGAGACTCTGAAGCATGAGAA pLKO.1 332 CDS 100% 4.950 3.465 N Fcer1g n/a
5 TRCN0000067589 CAGCTCTGCTATATCCTGGAT pLKO.1 171 CDS 100% 2.640 1.848 N Fcer1g n/a
6 TRCN0000067592 GTGAGAAAGCAGATGCTGTCT pLKO.1 277 CDS 100% 2.640 1.848 N Fcer1g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010185.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489347 ATCGAATCGTCGATAAACGTCTCT pLX_317 100% 88.3% 88.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_10819 pDONR223 100% 87.3% 87.3% None (many diffs) n/a
3 ccsbBroad304_10819 pLX_304 0% 87.3% 87.3% V5 (many diffs) n/a
4 TRCN0000465328 CGGGGACCCTCTCATCGACTCACT pLX_317 100% 87.3% 87.3% V5 (many diffs) n/a
Download CSV