Transcript: Mouse NM_010312.4

Mus musculus guanine nucleotide binding protein (G protein), beta 2 (Gnb2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gnb2 (14693)
Length:
1593
CDS:
181..1203

Additional Resources:

NCBI RefSeq record:
NM_010312.4
NBCI Gene record:
Gnb2 (14693)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010312.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109294 CAGGACGGAAAGCTCATCATT pLKO.1 403 CDS 100% 5.625 3.938 N Gnb2 n/a
2 TRCN0000309914 CAGGACGGAAAGCTCATCATT pLKO_005 403 CDS 100% 5.625 3.938 N Gnb2 n/a
3 TRCN0000109293 CCTGGACGACAACCAAATCAT pLKO.1 633 CDS 100% 5.625 3.938 N Gnb2 n/a
4 TRCN0000334735 CCTGGACGACAACCAAATCAT pLKO_005 633 CDS 100% 5.625 3.938 N Gnb2 n/a
5 TRCN0000109292 CGACGACTTCAACTGCAACAT pLKO.1 1047 CDS 100% 4.950 3.465 N Gnb2 n/a
6 TRCN0000331994 CGACGACTTCAACTGCAACAT pLKO_005 1047 CDS 100% 4.950 3.465 N Gnb2 n/a
7 TRCN0000109291 GCTCATGTATTCCCACGACAA pLKO.1 963 CDS 100% 4.050 2.835 N Gnb2 n/a
8 TRCN0000309853 GCTCATGTATTCCCACGACAA pLKO_005 963 CDS 100% 4.050 2.835 N Gnb2 n/a
9 TRCN0000109290 CCTGCTCCCATACCCAGGTTT pLKO.1 1327 3UTR 100% 1.650 1.155 N Gnb2 n/a
10 TRCN0000351283 CCTGCTCCCATACCCAGGTTT pLKO_005 1327 3UTR 100% 1.650 1.155 N Gnb2 n/a
11 TRCN0000029519 GCCCTGCCCATGCCCACACTA pLKO.1 1239 3UTR 100% 0.000 0.000 N GNB2 n/a
12 TRCN0000278855 GCCCTGCCCATGCCCACACTA pLKO_005 1239 3UTR 100% 0.000 0.000 N GNB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010312.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06297 pDONR223 100% 92.7% 100% None (many diffs) n/a
2 ccsbBroad304_06297 pLX_304 0% 92.7% 100% V5 (many diffs) n/a
3 TRCN0000475025 GATTCCCGACGGCGCCTATTGAGT pLX_317 50.8% 92.7% 100% V5 (many diffs) n/a
4 ccsbBroadEn_00655 pDONR223 100% 92.6% 100% None (many diffs) n/a
5 ccsbBroad304_00655 pLX_304 0% 92.6% 100% V5 (many diffs) n/a
6 TRCN0000472058 GGGAACAATCACATTGATCACTTT pLX_317 45.7% 92.6% 100% V5 (many diffs) n/a
Download CSV