Transcript: Mouse NM_010612.2

Mus musculus kinase insert domain protein receptor (Kdr), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Kdr (16542)
Length:
5464
CDS:
261..4298

Additional Resources:

NCBI RefSeq record:
NM_010612.2
NBCI Gene record:
Kdr (16542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055072 GACATCTTGATTGTGGCATTT pLKO.1 2121 CDS 100% 10.800 15.120 N Kdr n/a
2 TRCN0000055069 CCAGATGAATTGCCCTTGGAT pLKO.1 2676 CDS 100% 3.000 4.200 N Kdr n/a
3 TRCN0000023748 GCATCTCATCTGTTACAGCTT pLKO.1 3263 CDS 100% 2.640 2.112 N Kdr n/a
4 TRCN0000023745 GCCCGTATGCTTGTAAAGAAT pLKO.1 1687 CDS 100% 5.625 3.938 N Kdr n/a
5 TRCN0000023744 GCCGTCAAGATGTTGAAAGAA pLKO.1 2850 CDS 100% 5.625 3.938 N Kdr n/a
6 TRCN0000023747 CCCACACATTACATGGTTCAA pLKO.1 2339 CDS 100% 4.950 3.465 N Kdr n/a
7 TRCN0000055070 CCCTGTGAAGTATCTCAGTTA pLKO.1 1316 CDS 100% 4.950 3.465 N Kdr n/a
8 TRCN0000055071 CTTGCATCAGAAGAGCTGAAA pLKO.1 4044 CDS 100% 4.950 3.465 N Kdr n/a
9 TRCN0000023746 GCCTCCACTGTTTATGTCTAT pLKO.1 597 CDS 100% 4.950 3.465 N Kdr n/a
10 TRCN0000055068 CGTGATTCTGAGGAAAGGGTA pLKO.1 462 CDS 100% 2.640 1.848 N Kdr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14684 pDONR223 0% 84.7% 85.7% None (many diffs) n/a
2 ccsbBroad304_14684 pLX_304 0% 84.7% 85.7% V5 (many diffs) n/a
3 TRCN0000471918 CTATACACTAATTATCGGTAATCG pLX_317 12% 84.7% 85.7% V5 (many diffs) n/a
4 TRCN0000487801 GGTCAACACTCCCGGCTGCAGGCC pLX_317 7% 84.7% 85.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000492241 TTATACGGTATATTGTTACCGGTG pLX_317 4.9% 84.6% 85.6% V5 (many diffs) n/a
6 TRCN0000489487 GTTCCAAAAGCTGGTGCGCGAGGT pLX_317 25% 36% 37.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV