Transcript: Mouse NM_010730.2

Mus musculus annexin A1 (Anxa1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Anxa1 (16952)
Length:
1395
CDS:
75..1115

Additional Resources:

NCBI RefSeq record:
NM_010730.2
NBCI Gene record:
Anxa1 (16952)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109725 GCTTTGGCAGATAAGTCTAAT pLKO.1 1199 3UTR 100% 13.200 18.480 N Anxa1 n/a
2 TRCN0000327420 GCTTTGGCAGATAAGTCTAAT pLKO_005 1199 3UTR 100% 13.200 18.480 N Anxa1 n/a
3 TRCN0000109726 CCGTTCGGAAATTGACATGAA pLKO.1 980 CDS 100% 4.950 6.930 N Anxa1 n/a
4 TRCN0000327421 CCGTTCGGAAATTGACATGAA pLKO_005 980 CDS 100% 4.950 6.930 N Anxa1 n/a
5 TRCN0000109728 GCACAAAGCTATCATGGTTAA pLKO.1 227 CDS 100% 10.800 7.560 N Anxa1 n/a
6 TRCN0000327419 GCACAAAGCTATCATGGTTAA pLKO_005 227 CDS 100% 10.800 7.560 N Anxa1 n/a
7 TRCN0000109727 GCAACCATCATTGACATTCTT pLKO.1 261 CDS 100% 5.625 3.938 N Anxa1 n/a
8 TRCN0000109729 GTGAATCAAGATTTGGCTGAT pLKO.1 654 CDS 100% 4.050 2.835 N Anxa1 n/a
9 TRCN0000327418 GTGAATCAAGATTTGGCTGAT pLKO_005 654 CDS 100% 4.050 2.835 N Anxa1 n/a
10 TRCN0000382247 GAGATCTGGCCAAAGACATAA pLKO_005 559 CDS 100% 13.200 9.240 N ANXA1 n/a
11 TRCN0000056100 GCAACCATCATTGACATTCTA pLKO.1 261 CDS 100% 5.625 3.938 N ANXA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05822 pDONR223 100% 86.8% 87.5% None (many diffs) n/a
2 ccsbBroad304_05822 pLX_304 0% 86.8% 87.5% V5 (many diffs) n/a
3 TRCN0000473840 GCGGGAGGACGTCTCCATTAACTA pLX_317 41% 86.8% 87.5% V5 (many diffs) n/a
4 ccsbBroadEn_05821 pDONR223 100% 86.7% 87.5% None (many diffs) n/a
5 ccsbBroad304_05821 pLX_304 0% 86.7% 87.5% V5 (many diffs) n/a
6 TRCN0000479447 GCCACAATTCTAGTGTGCTGTACT pLX_317 35.8% 86.7% 87.5% V5 (many diffs) n/a
Download CSV