Transcript: Mouse NM_010765.2

Mus musculus MAP kinase-activated protein kinase 5 (Mapkapk5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mapkapk5 (17165)
Length:
2229
CDS:
693..2114

Additional Resources:

NCBI RefSeq record:
NM_010765.2
NBCI Gene record:
Mapkapk5 (17165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024194 CCGGAATTAGTGGTCCAGTTA pLKO.1 781 CDS 100% 4.950 6.930 N Mapkapk5 n/a
2 TRCN0000345172 TCGCCAACACCCTACACTTAC pLKO_005 1326 CDS 100% 10.800 8.640 N Mapkapk5 n/a
3 TRCN0000024195 CCCAACATAGTTCAGATTATT pLKO.1 909 CDS 100% 15.000 10.500 N Mapkapk5 n/a
4 TRCN0000024196 CCAAGCCAAAGGACGGTATTT pLKO.1 1795 CDS 100% 13.200 9.240 N Mapkapk5 n/a
5 TRCN0000345119 CCAAGCCAAAGGACGGTATTT pLKO_005 1795 CDS 100% 13.200 9.240 N Mapkapk5 n/a
6 TRCN0000024198 GCACTGTCACTTGCTAAACAT pLKO.1 1103 CDS 100% 5.625 3.938 N Mapkapk5 n/a
7 TRCN0000345170 GCACTGTCACTTGCTAAACAT pLKO_005 1103 CDS 100% 5.625 3.938 N Mapkapk5 n/a
8 TRCN0000024197 GCTAAAGTTGACCAAGGTGAT pLKO.1 1209 CDS 100% 4.050 2.835 N Mapkapk5 n/a
9 TRCN0000345171 GCTAAAGTTGACCAAGGTGAT pLKO_005 1209 CDS 100% 4.050 2.835 N Mapkapk5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01952 pDONR223 100% 90.3% 96.8% None (many diffs) n/a
2 ccsbBroad304_01952 pLX_304 0% 90.3% 96.8% V5 (many diffs) n/a
3 TRCN0000465246 CTAGCATGTCGTGCTTTATCCATG pLX_317 22.7% 90.3% 96.8% V5 (many diffs) n/a
4 ccsbBroadEn_14902 pDONR223 0% 90.3% 96.8% None (many diffs) n/a
5 ccsbBroad304_14902 pLX_304 0% 90.3% 96.8% V5 (many diffs) n/a
6 TRCN0000488301 ATACTCCTTTGTCCGTGTTGTACT pLX_317 24.4% 90.3% 96.8% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488288 TTTCCATTCCCTGTCAACTTAGGG pLX_317 27.1% 90.2% 96.6% V5 (many diffs) n/a
Download CSV