Transcript: Mouse NM_010787.2

Mus musculus male enhanced antigen 1 (Mea1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mea1 (17256)
Length:
877
CDS:
97..621

Additional Resources:

NCBI RefSeq record:
NM_010787.2
NBCI Gene record:
Mea1 (17256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319526 TTGAGCAGCCACAGCTCTATC pLKO_005 436 CDS 100% 10.800 8.640 N Mea1 n/a
2 TRCN0000416138 ATGGGCCCTGAGCGTATCTTC pLKO_005 127 CDS 100% 1.650 1.320 N MEA1 n/a
3 TRCN0000106395 GACTAACAACTCTGGTCTTAA pLKO.1 674 3UTR 100% 13.200 9.240 N Mea1 n/a
4 TRCN0000317721 GACTAACAACTCTGGTCTTAA pLKO_005 674 3UTR 100% 13.200 9.240 N Mea1 n/a
5 TRCN0000106398 GAACATGTAGAGCTGGTGAAA pLKO.1 469 CDS 100% 4.950 3.465 N Mea1 n/a
6 TRCN0000317720 GAACATGTAGAGCTGGTGAAA pLKO_005 469 CDS 100% 4.950 3.465 N Mea1 n/a
7 TRCN0000415058 GAACATGTAGAGCTGGTGAAA pLKO_005 469 CDS 100% 4.950 3.465 N MEA1 n/a
8 TRCN0000106399 AGCAGTGAAGAACCCGAGGAA pLKO.1 208 CDS 100% 2.640 1.848 N Mea1 n/a
9 TRCN0000317719 AGCAGTGAAGAACCCGAGGAA pLKO_005 208 CDS 100% 2.640 1.848 N Mea1 n/a
10 TRCN0000106396 CCTCCATTGGAGAGTGAGGAT pLKO.1 391 CDS 100% 2.640 1.848 N Mea1 n/a
11 TRCN0000106397 GTGGGAAGATGTGGTACAGAA pLKO.1 561 CDS 100% 4.950 2.970 N Mea1 n/a
12 TRCN0000317640 GTGGGAAGATGTGGTACAGAA pLKO_005 561 CDS 100% 4.950 2.970 N Mea1 n/a
13 TRCN0000430790 GTGGGAAGATGTGGTACAGAA pLKO_005 561 CDS 100% 4.950 2.970 N MEA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00994 pDONR223 100% 84.3% 86.6% None (many diffs) n/a
2 ccsbBroad304_00994 pLX_304 0% 84.3% 86.6% V5 (many diffs) n/a
3 TRCN0000479059 GGATACACTCTCTCCACATCCCTT pLX_317 70.4% 84.3% 86.6% V5 (many diffs) n/a
Download CSV