Transcript: Mouse NM_010956.4

Mus musculus oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) (Ogdh), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ogdh (18293)
Length:
6630
CDS:
124..3195

Additional Resources:

NCBI RefSeq record:
NM_010956.4
NBCI Gene record:
Ogdh (18293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010956.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295209 CACAACCTAACGTCGACAAAC pLKO_005 470 CDS 100% 10.800 15.120 N Ogdh n/a
2 TRCN0000041905 CCTGGACGCATTCAAGAAATT pLKO.1 3168 CDS 100% 13.200 9.240 N Ogdh n/a
3 TRCN0000287827 CCTGGACGCATTCAAGAAATT pLKO_005 3168 CDS 100% 13.200 9.240 N Ogdh n/a
4 TRCN0000295280 GCTCTTTGCTTCTCAACTAAA pLKO_005 3239 3UTR 100% 13.200 9.240 N Ogdh n/a
5 TRCN0000295207 GGAAATCTCCAAGTATGATAA pLKO_005 1794 CDS 100% 13.200 9.240 N Ogdh n/a
6 TRCN0000041906 CTGGTGTGTTATCGACGAAAT pLKO.1 1636 CDS 100% 10.800 7.560 N Ogdh n/a
7 TRCN0000287828 CTGGTGTGTTATCGACGAAAT pLKO_005 1636 CDS 100% 10.800 7.560 N Ogdh n/a
8 TRCN0000041903 CCAGCAGCAATTAGGACGTTT pLKO.1 205 CDS 100% 4.950 3.465 N Ogdh n/a
9 TRCN0000041907 CCTGAGGCAAGAACTAGCTTT pLKO.1 2719 CDS 100% 4.950 3.465 N Ogdh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010956.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15515 pDONR223 0% 37.7% 39% None (many diffs) n/a
2 ccsbBroad304_15515 pLX_304 0% 37.7% 39% V5 (many diffs) n/a
3 TRCN0000479889 AACGTAAGATGCATCTGACTCGGC pLX_317 29.4% 37.7% 39% V5 (many diffs) n/a
Download CSV