Transcript: Mouse NM_011032.2

Mus musculus prolyl 4-hydroxylase, beta polypeptide (P4hb), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
P4hb (18453)
Length:
2538
CDS:
130..1659

Additional Resources:

NCBI RefSeq record:
NM_011032.2
NBCI Gene record:
P4hb (18453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111869 CAGCGCATACTTGAGTTCTTT pLKO.1 1030 CDS 100% 5.625 7.875 N P4hb n/a
2 TRCN0000111868 GCTCTGAGATTCGACTAGCAA pLKO.1 356 CDS 100% 3.000 4.200 N P4hb n/a
3 TRCN0000111867 CCCAAGAGTGTATCTGACTAT pLKO.1 919 CDS 100% 4.950 3.465 N P4hb n/a
4 TRCN0000111866 GCAGAGGCTATTGATGACATA pLKO.1 661 CDS 100% 4.950 3.465 N P4hb n/a
5 TRCN0000111865 GCATTTCATCTGTGAGGCATT pLKO.1 2016 3UTR 100% 4.050 2.835 N P4hb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01138 pDONR223 100% 86.4% 93.7% None (many diffs) n/a
2 ccsbBroad304_01138 pLX_304 20% 86.4% 93.7% V5 (many diffs) n/a
3 TRCN0000468664 CCATCTATCAACAGGTAATGGCCA pLX_317 30.5% 86.4% 93.7% V5 (many diffs) n/a
4 ccsbBroadEn_15517 pDONR223 0% 31.1% 34.5% None (many diffs) n/a
5 ccsbBroad304_15517 pLX_304 0% 31.1% 34.5% V5 (many diffs) n/a
6 TRCN0000491712 GCGTGGTCCATTCAGGTCCCAGTT pLX_317 64.1% 31.1% 34.5% V5 (many diffs) n/a
Download CSV