Transcript: Mouse NM_011137.3

Mus musculus POU domain, class 2, transcription factor 1 (Pou2f1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pou2f1 (18986)
Length:
12978
CDS:
13..2394

Additional Resources:

NCBI RefSeq record:
NM_011137.3
NBCI Gene record:
Pou2f1 (18986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011137.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240640 ACAACACGGCCACGGTGATTT pLKO_005 1673 CDS 100% 13.200 18.480 N Pou2f1 n/a
2 TRCN0000020768 CCAGTCAACACCAAAGCGAAT pLKO.1 885 CDS 100% 4.050 5.670 N POU2F1 n/a
3 TRCN0000240636 TAAGAACATGTGCAAGTTAAA pLKO_005 1092 CDS 100% 13.200 10.560 N Pou2f1 n/a
4 TRCN0000240638 CAGTGAAGAGTCGGGAGATTC pLKO_005 303 CDS 100% 10.800 8.640 N Pou2f1 n/a
5 TRCN0000175063 GTACAGTCTAAATCCAGTGAA pLKO.1 289 CDS 100% 4.950 3.960 N Pou2f1 n/a
6 TRCN0000176291 CAACGATTCAAGCTCTTGCTT pLKO.1 2072 CDS 100% 3.000 2.400 N Pou2f1 n/a
7 TRCN0000232120 GCAACTGGGAACCTGGTATTT pLKO_005 2125 CDS 100% 13.200 9.240 N POU2F1 n/a
8 TRCN0000240639 GCAACTGGGAACCTGGTATTT pLKO_005 2125 CDS 100% 13.200 9.240 N Pou2f1 n/a
9 TRCN0000240637 TTCCTCACTACAGGGTGATAG pLKO_005 2425 3UTR 100% 10.800 7.560 N Pou2f1 n/a
10 TRCN0000175090 GCTGCTCAGTCTTTAAATGTA pLKO.1 271 CDS 100% 5.625 3.938 N Pou2f1 n/a
11 TRCN0000173948 GCCCTAATGAGCAACAGTACA pLKO.1 2047 CDS 100% 4.950 3.465 N Pou2f1 n/a
12 TRCN0000176221 GCTGAACAGCTCAATATGGAA pLKO.1 1327 CDS 100% 3.000 2.100 N Pou2f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011137.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11046 pDONR223 100% 84.8% 87.6% None (many diffs) n/a
2 ccsbBroad304_11046 pLX_304 0% 84.8% 87.6% V5 (many diffs) n/a
3 TRCN0000471094 GGGAGACTGCATGAGGCTTGATTA pLX_317 19.3% 84.8% 87.6% V5 (many diffs) n/a
Download CSV