Transcript: Mouse NM_011293.2

Mus musculus polymerase (RNA) II (DNA directed) polypeptide J (Polr2j), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Polr2j (20022)
Length:
586
CDS:
63..416

Additional Resources:

NCBI RefSeq record:
NM_011293.2
NBCI Gene record:
Polr2j (20022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111373 CAAGGACACTAAGGTTCCCAA pLKO.1 128 CDS 100% 2.640 3.696 N Polr2j n/a
2 TRCN0000332515 CAAGGACACTAAGGTTCCCAA pLKO_005 128 CDS 100% 2.640 3.696 N Polr2j n/a
3 TRCN0000111370 AGCTGAAAGAAGCGTTGCTTA pLKO.1 418 3UTR 100% 4.950 3.465 N Polr2j n/a
4 TRCN0000332516 AGCTGAAAGAAGCGTTGCTTA pLKO_005 418 3UTR 100% 4.950 3.465 N Polr2j n/a
5 TRCN0000111374 CACCATTAACAAGGACACTAA pLKO.1 119 CDS 100% 4.950 3.465 N Polr2j n/a
6 TRCN0000428441 CCCTTGGAGCACAAGATCATC pLKO_005 258 CDS 100% 4.950 3.465 N POLR2J2 n/a
7 TRCN0000152711 CTTGGAGCACAAGATCATCAT pLKO.1 260 CDS 100% 4.950 3.465 N POLR2J3 n/a
8 TRCN0000111371 GCCATCAAGGACAAGCAAGAA pLKO.1 384 CDS 100% 4.950 3.465 N Polr2j n/a
9 TRCN0000332517 GCCATCAAGGACAAGCAAGAA pLKO_005 384 CDS 100% 4.950 3.465 N Polr2j n/a
10 TRCN0000111372 CATCATTAAATCGCAGCTGTT pLKO.1 194 CDS 100% 4.050 2.835 N Polr2j n/a
11 TRCN0000332445 CATCATTAAATCGCAGCTGTT pLKO_005 194 CDS 100% 4.050 2.835 N Polr2j n/a
12 TRCN0000053032 CCATCAACAAAGAAGACCACA pLKO.1 163 CDS 100% 2.640 1.848 N POLR2J2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01243 pDONR223 100% 89.7% 100% None (many diffs) n/a
2 ccsbBroad304_01243 pLX_304 0% 89.7% 100% V5 (many diffs) n/a
3 TRCN0000474650 ACAATCGTGAGTCTTCATTCAACT pLX_317 94.6% 89.7% 100% V5 (many diffs) n/a
Download CSV