Transcript: Mouse NM_011295.6

Mus musculus ribosomal protein S12 (Rps12), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rps12 (20042)
Length:
535
CDS:
92..490

Additional Resources:

NCBI RefSeq record:
NM_011295.6
NBCI Gene record:
Rps12 (20042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011295.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104195 GCACCAAATCAACCTGATAAA pLKO.1 304 CDS 100% 13.200 18.480 N Rps12 n/a
2 TRCN0000437075 GCGTAGTGGTTAAGGACTATG pLKO_005 414 CDS 100% 10.800 8.640 N Rps12 n/a
3 TRCN0000442301 ACGTCAACACTGCTCTACAAG pLKO_005 129 CDS 100% 4.950 3.465 N Rps12 n/a
4 TRCN0000104199 CAACTGTGATGAGCCCATGTA pLKO.1 253 CDS 100% 4.950 3.465 N Rps12 n/a
5 TRCN0000104196 CCTGATAAAGGTTGATGACAA pLKO.1 316 CDS 100% 4.950 3.465 N Rps12 n/a
6 TRCN0000438185 GAATGGGTAGGCCTCTGTAAA pLKO_005 350 CDS 100% 13.200 7.920 N Rps12 n/a
7 TRCN0000104197 GTTGATGACAACAAGAAACTA pLKO.1 326 CDS 100% 5.625 3.375 N Rps12 n/a
8 TRCN0000104198 AGCTGCCAAAGCCTTAGACAA pLKO.1 202 CDS 100% 4.950 2.970 N Rps12 n/a
9 TRCN0000436479 CAAGGATGTCATCGAGGAATA pLKO_005 451 CDS 100% 10.800 5.400 Y Rps12 n/a
10 TRCN0000303318 CGAAGCTGCCAAAGCCTTAGA pLKO_005 199 CDS 100% 4.950 2.475 Y RPS12 n/a
11 TRCN0000236717 ACAAGCGCCAAGCCCATCTTT pLKO_005 219 CDS 100% 5.625 3.375 N RPS12P4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011295.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13948 pDONR223 100% 90.9% 99.2% None (many diffs) n/a
2 ccsbBroad304_13948 pLX_304 0% 90.9% 99.2% V5 (many diffs) n/a
3 TRCN0000466110 TACGGTTTCCTATGTTTGGATCTT pLX_317 92% 90.9% 99.2% V5 (many diffs) n/a
Download CSV