Transcript: Mouse NM_011303.6

Mus musculus dehydrogenase/reductase (SDR family) member 3 (Dhrs3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dhrs3 (20148)
Length:
1731
CDS:
379..1287

Additional Resources:

NCBI RefSeq record:
NM_011303.6
NBCI Gene record:
Dhrs3 (20148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011303.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313679 GAACTCCAGAACGGCCATATT pLKO_005 868 CDS 100% 13.200 18.480 N Dhrs3 n/a
2 TRCN0000041949 CCCTCTGCAAATGATCTATTT pLKO.1 414 CDS 100% 13.200 10.560 N Dhrs3 n/a
3 TRCN0000317208 CCCTCTGCAAATGATCTATTT pLKO_005 414 CDS 100% 13.200 10.560 N Dhrs3 n/a
4 TRCN0000313678 GCCTGATGTGCATCTACTATT pLKO_005 1577 3UTR 100% 13.200 10.560 N Dhrs3 n/a
5 TRCN0000041950 CGGTAGATGCTGTGCAACAAA pLKO.1 1127 CDS 100% 5.625 4.500 N Dhrs3 n/a
6 TRCN0000317281 CGGTAGATGCTGTGCAACAAA pLKO_005 1127 CDS 100% 5.625 4.500 N Dhrs3 n/a
7 TRCN0000041952 CACCTGTATGAACACCTTTAA pLKO.1 1254 CDS 100% 13.200 9.240 N Dhrs3 n/a
8 TRCN0000317282 CACCTGTATGAACACCTTTAA pLKO_005 1254 CDS 100% 13.200 9.240 N Dhrs3 n/a
9 TRCN0000041951 GCCATATTGTGTGCCTCAATT pLKO.1 881 CDS 100% 13.200 9.240 N Dhrs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011303.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07379 pDONR223 100% 88.1% 95% None (many diffs) n/a
2 ccsbBroad304_07379 pLX_304 0% 88.1% 95% V5 (many diffs) n/a
3 TRCN0000480411 CGGCCAGTATTTACATAGGTATCG pLX_317 40.2% 88.1% 95% V5 (many diffs) n/a
Download CSV