Transcript: Mouse NM_011375.3

Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 5 (St3gal5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
St3gal5 (20454)
Length:
2453
CDS:
390..1553

Additional Resources:

NCBI RefSeq record:
NM_011375.3
NBCI Gene record:
St3gal5 (20454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011375.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304995 TGCACCTCTTCGTCCTATTTA pLKO_005 1727 3UTR 100% 15.000 21.000 N St3gal5 n/a
2 TRCN0000305028 TGTGGACCCTGACCGGATAAA pLKO_005 602 CDS 100% 13.200 18.480 N St3gal5 n/a
3 TRCN0000077111 GACGTTGAATACTACGCCAAT pLKO.1 1059 CDS 100% 4.050 3.240 N St3gal5 n/a
4 TRCN0000302841 GACGTTGAATACTACGCCAAT pLKO_005 1059 CDS 100% 4.050 3.240 N St3gal5 n/a
5 TRCN0000077110 CGATGTGGTAATAAGGTTGAA pLKO.1 953 CDS 100% 4.950 3.465 N St3gal5 n/a
6 TRCN0000302842 CGATGTGGTAATAAGGTTGAA pLKO_005 953 CDS 100% 4.950 3.465 N St3gal5 n/a
7 TRCN0000077109 CGCTGAAGAATGTGACATGAA pLKO.1 569 CDS 100% 4.950 3.465 N St3gal5 n/a
8 TRCN0000302927 CGCTGAAGAATGTGACATGAA pLKO_005 569 CDS 100% 4.950 3.465 N St3gal5 n/a
9 TRCN0000222636 CAGCATCAACTTGGAGCCTTT pLKO.1 716 CDS 100% 4.050 2.835 N St3gal5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011375.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11315 pDONR223 100% 84.1% 85.1% None (many diffs) n/a
2 ccsbBroad304_11315 pLX_304 0% 84.1% 85.1% V5 (many diffs) n/a
3 TRCN0000471221 CTCTTGCTCCGCTGCCTTCCCTAG pLX_317 38.4% 84.1% 85.1% V5 (many diffs) n/a
Download CSV