Transcript: Mouse NM_011397.4

Mus musculus solute carrier family 23 (nucleobase transporters), member 1 (Slc23a1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc23a1 (20522)
Length:
3009
CDS:
91..1908

Additional Resources:

NCBI RefSeq record:
NM_011397.4
NBCI Gene record:
Slc23a1 (20522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011397.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070112 CGGTGCAGGTATCATGCTAAT pLKO.1 1317 CDS 100% 10.800 15.120 N Slc23a1 n/a
2 TRCN0000070108 CGGTGGGTGTACTTACATATA pLKO.1 2837 3UTR 100% 13.200 9.240 N Slc23a1 n/a
3 TRCN0000070111 GCCTCTCAACACCTCCCATAT pLKO.1 534 CDS 100% 10.800 7.560 N Slc23a1 n/a
4 TRCN0000070109 CCTTGCTTTCATACTGGACAA pLKO.1 1629 CDS 100% 4.050 2.835 N Slc23a1 n/a
5 TRCN0000070110 GCAACCTCTTTGTATTGGGAT pLKO.1 1478 CDS 100% 2.640 1.848 N Slc23a1 n/a
6 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 2747 3UTR 100% 2.640 1.320 Y P3h3 n/a
7 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 2747 3UTR 100% 2.640 1.320 Y P3h3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011397.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11438 pDONR223 100% 36.9% 36.6% None (many diffs) n/a
2 ccsbBroad304_11438 pLX_304 0% 36.9% 36.6% V5 (many diffs) n/a
3 TRCN0000474619 TGAACAGTTAGGAGAACGGCCTGG pLX_317 67.6% 36.9% 36.6% V5 (many diffs) n/a
Download CSV