Transcript: Mouse NM_011507.3

Mus musculus succinate-Coenzyme A ligase, GDP-forming, beta subunit (Suclg2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Suclg2 (20917)
Length:
3447
CDS:
72..1373

Additional Resources:

NCBI RefSeq record:
NM_011507.3
NBCI Gene record:
Suclg2 (20917)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120826 CCAGTCCAGAACTCATCTTTA pLKO.1 622 CDS 100% 13.200 9.240 N Suclg2 n/a
2 TRCN0000341674 CCAGTCCAGAACTCATCTTTA pLKO_005 622 CDS 100% 13.200 9.240 N Suclg2 n/a
3 TRCN0000120824 GCCAGATACGATCTCAAGTAT pLKO.1 942 CDS 100% 5.625 3.938 N Suclg2 n/a
4 TRCN0000341675 GCCAGATACGATCTCAAGTAT pLKO_005 942 CDS 100% 5.625 3.938 N Suclg2 n/a
5 TRCN0000120822 CCACCTCACATCTATCAGTTT pLKO.1 2102 3UTR 100% 4.950 3.465 N Suclg2 n/a
6 TRCN0000341676 CCACCTCACATCTATCAGTTT pLKO_005 2102 3UTR 100% 4.950 3.465 N Suclg2 n/a
7 TRCN0000120825 CGTCAATATCTTTGGTGGGAT pLKO.1 1151 CDS 100% 2.640 1.848 N Suclg2 n/a
8 TRCN0000120823 CCCTGGATATTTCTAGAGAAA pLKO.1 508 CDS 100% 4.950 2.970 N Suclg2 n/a
9 TRCN0000341673 CCCTGGATATTTCTAGAGAAA pLKO_005 508 CDS 100% 4.950 2.970 N Suclg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11305 pDONR223 100% 78.5% 83.8% None (many diffs) n/a
2 ccsbBroad304_11305 pLX_304 0% 78.5% 83.8% V5 (many diffs) n/a
3 TRCN0000480412 ACAAGATCCAATTGACGCAGGTAT pLX_317 26.2% 78.5% 83.8% V5 (many diffs) n/a
Download CSV