Transcript: Mouse NM_011508.2

Mus musculus eukaryotic translation initiation factor 1 (Eif1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Eif1 (20918)
Length:
1279
CDS:
182..523

Additional Resources:

NCBI RefSeq record:
NM_011508.2
NBCI Gene record:
Eif1 (20918)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310713 TAGTCTTGAAGTCCCTCATTT pLKO_005 704 3UTR 100% 13.200 10.560 N EIF1 n/a
2 TRCN0000247466 ACTTGAACAGAATGGGTAACA pLKO_005 885 3UTR 100% 4.950 3.465 N Eif1 n/a
3 TRCN0000216914 CTTGAACAGAATGGGTAACAC pLKO.1 886 3UTR 100% 4.950 3.465 N Eif1 n/a
4 TRCN0000189810 GCTGATGCAAGTAAGGGTGAT pLKO.1 221 CDS 100% 4.050 2.835 N Eif1 n/a
5 TRCN0000265818 GTGACCAGCGCAAGAACATAT pLKO_005 441 CDS 100% 13.200 7.920 N Gm16378 n/a
6 TRCN0000189739 GCGCAAGAACATATGCCAGTT pLKO.1 448 CDS 100% 0.000 0.000 N Eif1 n/a
7 TRCN0000310709 GTAACTCCTTCATGCAATAAA pLKO_005 663 3UTR 100% 15.000 7.500 Y EIF1 n/a
8 TRCN0000240338 TGCTGGCACTGAGGATTATAT pLKO_005 253 CDS 100% 15.000 7.500 Y EIF1P3 n/a
9 TRCN0000247467 TGCTGGCACTGAGGATTATAT pLKO_005 253 CDS 100% 15.000 7.500 Y Eif1 n/a
10 TRCN0000270619 ACTGAGGATTATATCCATATA pLKO_005 260 CDS 100% 13.200 6.600 Y Gm6900 n/a
11 TRCN0000257794 ATCGCTGATGATTACGATAAA pLKO_005 329 CDS 100% 13.200 6.600 Y Eif1 n/a
12 TRCN0000257768 CAGAATATGGAGAAGTAATTC pLKO_005 411 CDS 100% 13.200 6.600 Y Eif1 n/a
13 TRCN0000256440 CCTGCAATGGTACTGTAATTG pLKO_005 384 CDS 100% 13.200 6.600 Y Gm16378 n/a
14 TRCN0000270676 GTAATTGAGCATCCAGAATAT pLKO_005 398 CDS 100% 13.200 6.600 Y Gm6900 n/a
15 TRCN0000240339 CCCTTTGCTGATGCAAGTAAG pLKO_005 215 CDS 100% 10.800 5.400 Y EIF1P3 n/a
16 TRCN0000247468 CCCTTTGCTGATGCAAGTAAG pLKO_005 215 CDS 100% 10.800 5.400 Y Eif1 n/a
17 TRCN0000256437 GATCGCTGATGATTACGATAA pLKO_005 328 CDS 100% 10.800 5.400 Y Gm16378 n/a
18 TRCN0000284438 TGTGGCTCTCTGAAGCTTAAG pLKO_005 529 3UTR 100% 10.800 5.400 Y Gm6900 n/a
19 TRCN0000061750 GCACTGAGGATTATATCCATA pLKO.1 258 CDS 100% 4.950 2.475 Y EIF1 n/a
20 TRCN0000061752 TGGAGAAGTAATTCAGCTACA pLKO.1 418 CDS 100% 4.050 2.025 Y EIF1 n/a
21 TRCN0000315700 TGGAGAAGTAATTCAGCTACA pLKO_005 418 CDS 100% 4.050 2.025 Y EIF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011508.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02386 pDONR223 100% 81.7% 92% None (many diffs) n/a
2 ccsbBroad304_02386 pLX_304 0% 81.7% 92% V5 (many diffs) n/a
3 TRCN0000472609 CCAACCTAATTGTATATGATGCAA pLX_317 100% 81.7% 92% V5 (many diffs) n/a
Download CSV