Transcript: Mouse NM_011541.4

Mus musculus transcription elongation factor A (SII) 1 (Tcea1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tcea1 (21399)
Length:
2727
CDS:
221..1126

Additional Resources:

NCBI RefSeq record:
NM_011541.4
NBCI Gene record:
Tcea1 (21399)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011541.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304411 GAATATTCCTCCTGATCTATT pLKO_005 859 CDS 100% 13.200 18.480 N Tcea1 n/a
2 TRCN0000304475 TCAGATTGAGGAAGCTATATA pLKO_005 730 CDS 100% 15.000 10.500 N Tcea1 n/a
3 TRCN0000304410 CAAAGTATCTGGACCATTAAG pLKO_005 1142 3UTR 100% 13.200 9.240 N Tcea1 n/a
4 TRCN0000304413 CTTCGGACAGGAGATGATTAT pLKO_005 674 CDS 100% 13.200 9.240 N Tcea1 n/a
5 TRCN0000084741 CTTCTGATTCTGTGCGATTAA pLKO.1 627 CDS 100% 13.200 9.240 N Tcea1 n/a
6 TRCN0000316013 CTTCTGATTCTGTGCGATTAA pLKO_005 627 CDS 100% 13.200 9.240 N Tcea1 n/a
7 TRCN0000084738 CCTCCTTTAGACTGAATCTTT pLKO.1 2009 3UTR 100% 5.625 3.938 N Tcea1 n/a
8 TRCN0000084739 GCACTTATACACAGGTGCAAA pLKO.1 1032 CDS 100% 4.950 3.465 N Tcea1 n/a
9 TRCN0000084740 GCACTTCTGATTCTGTGCGAT pLKO.1 624 CDS 100% 2.640 1.848 N Tcea1 n/a
10 TRCN0000084742 GCAGCAGAAAGGATGAGACAA pLKO.1 561 CDS 100% 4.950 2.970 N Tcea1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011541.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01650 pDONR223 100% 92.2% 96.6% None (many diffs) n/a
2 ccsbBroad304_01650 pLX_304 0% 92.2% 96.6% V5 (many diffs) n/a
3 TRCN0000480510 AGAATGCTCGGCGCCACTGGGGGG pLX_317 47.6% 92.2% 96.6% V5 (many diffs) n/a
Download CSV