Transcript: Mouse NM_011629.3

Mus musculus nuclear receptor subfamily 2, group C, member 1 (Nr2c1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nr2c1 (22025)
Length:
3827
CDS:
192..1964

Additional Resources:

NCBI RefSeq record:
NM_011629.3
NBCI Gene record:
Nr2c1 (22025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011629.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255766 ACCTACAGGCTGTCGCGATTA pLKO_005 1782 CDS 100% 10.800 15.120 N Nr2c1 n/a
2 TRCN0000222445 CCATTGAAGTTTCCCGAGAAA pLKO.1 721 CDS 100% 4.950 6.930 N Nr2c1 n/a
3 TRCN0000222447 GCAACTATATTAGCAACGTTT pLKO.1 1494 CDS 100% 4.950 6.930 N Nr2c1 n/a
4 TRCN0000255767 CAAAGCATCAGGGCGTCATTA pLKO_005 509 CDS 100% 13.200 9.240 N Nr2c1 n/a
5 TRCN0000255768 TTGCTAAGTAATGCAATTATC pLKO_005 2864 3UTR 100% 13.200 9.240 N Nr2c1 n/a
6 TRCN0000255765 AGGATCCAAAGACTGCGTTAT pLKO_005 605 CDS 100% 10.800 7.560 N Nr2c1 n/a
7 TRCN0000255764 GGCTGATGAACGCTACCATTA pLKO_005 1825 CDS 100% 10.800 7.560 N Nr2c1 n/a
8 TRCN0000222446 GCAGGTGTCAACCAGTTGTTT pLKO.1 384 CDS 100% 5.625 3.938 N Nr2c1 n/a
9 TRCN0000222449 AGATTATATCACCAGGACATA pLKO.1 1751 CDS 100% 4.950 3.465 N Nr2c1 n/a
10 TRCN0000222448 GCCAGTGTGGTCACATCATTA pLKO.1 972 CDS 100% 13.200 7.920 N Nr2c1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011629.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01709 pDONR223 100% 64.5% 65.8% None (many diffs) n/a
2 ccsbBroad304_01709 pLX_304 0% 64.5% 65.8% V5 (many diffs) n/a
3 TRCN0000466565 GTAGGGGTTCACCGAAATCTACAC pLX_317 29.3% 64.5% 65.8% V5 (many diffs) n/a
4 TRCN0000488735 TATACCCAAGGGAGTGTTTATAAA pLX_317 19% 64.5% 65.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV