Transcript: Mouse NM_011778.2

Mus musculus coronin, actin binding protein 1B (Coro1b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Coro1b (23789)
Length:
1860
CDS:
77..1531

Additional Resources:

NCBI RefSeq record:
NM_011778.2
NBCI Gene record:
Coro1b (23789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090025 GCGGTCAGGATGCTAATCCAA pLKO.1 1218 CDS 100% 3.000 4.200 N Coro1b n/a
2 TRCN0000326504 GCGGTCAGGATGCTAATCCAA pLKO_005 1218 CDS 100% 3.000 4.200 N Coro1b n/a
3 TRCN0000090024 CCCTACATCCACTTCCTGAAT pLKO.1 980 CDS 100% 4.950 3.465 N Coro1b n/a
4 TRCN0000326503 CCCTACATCCACTTCCTGAAT pLKO_005 980 CDS 100% 4.950 3.465 N Coro1b n/a
5 TRCN0000090027 CGGTACTTTGAGATCACAGAT pLKO.1 953 CDS 100% 4.950 3.465 N Coro1b n/a
6 TRCN0000326571 CGGTACTTTGAGATCACAGAT pLKO_005 953 CDS 100% 4.950 3.465 N Coro1b n/a
7 TRCN0000090023 GCCAAGAAAGTCTGACCTCTT pLKO.1 1132 CDS 100% 4.050 2.835 N Coro1b n/a
8 TRCN0000326573 GCCAAGAAAGTCTGACCTCTT pLKO_005 1132 CDS 100% 4.050 2.835 N Coro1b n/a
9 TRCN0000090026 CTGCTCTTGAAGCAGAGGATT pLKO.1 1191 CDS 100% 0.495 0.347 N Coro1b n/a
10 TRCN0000354028 CTGCTCTTGAAGCAGAGGATT pLKO_005 1191 CDS 100% 0.495 0.347 N Coro1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03800 pDONR223 100% 86.5% 94% None (many diffs) n/a
2 ccsbBroad304_03800 pLX_304 0% 86.5% 94% V5 (many diffs) n/a
3 TRCN0000480922 TAACAATTTGGTCCCATTGATGCA pLX_317 27.3% 86.5% 94% V5 (many diffs) n/a
Download CSV