Transcript: Mouse NM_011843.2

Mus musculus extended synaptotagmin-like protein 1 (Esyt1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Esyt1 (23943)
Length:
3687
CDS:
37..3315

Additional Resources:

NCBI RefSeq record:
NM_011843.2
NBCI Gene record:
Esyt1 (23943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011843.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244623 TCACCGCAGAGACGCTTTATA pLKO_005 350 CDS 100% 15.000 21.000 N Esyt1 n/a
2 TRCN0000244622 TAGAAGCGCAGGACCTAATTG pLKO_005 1958 CDS 100% 13.200 18.480 N Esyt1 n/a
3 TRCN0000244624 TACGAATCATTGGCGTCAAAG pLKO_005 578 CDS 100% 10.800 15.120 N Esyt1 n/a
4 TRCN0000195831 CCTGAGTTCAATGAGCGGTTT pLKO.1 3103 CDS 100% 4.050 5.670 N Esyt1 n/a
5 TRCN0000180722 GTCAGCTATGTAGGTGATGTA pLKO.1 643 CDS 100% 4.950 3.960 N Esyt1 n/a
6 TRCN0000257059 AGGGACCTGAGCTGGCTATTT pLKO_005 3516 3UTR 100% 13.200 9.240 N Esyt1 n/a
7 TRCN0000217380 GATGACCAACCTGCTAGATAT pLKO.1 834 CDS 100% 13.200 9.240 N Esyt1 n/a
8 TRCN0000243846 GATGACCAACCTGCTAGATAT pLKO_005 834 CDS 100% 13.200 9.240 N Esyt1 n/a
9 TRCN0000184540 GCCTGTTACCTCTTCCTTCTT pLKO.1 3545 3UTR 100% 4.950 2.970 N Esyt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011843.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489166 CAGTTATTTTCTAATCTTTCAAAA pLX_317 9.8% 84.6% 87.1% V5 (many diffs) n/a
2 TRCN0000488479 GTCGCAACTTGCCGACAACTGGGC pLX_317 9.4% 84.6% 87.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV