Transcript: Mouse NM_011849.3

Mus musculus NIMA (never in mitosis gene a)-related expressed kinase 4 (Nek4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nek4 (23955)
Length:
4267
CDS:
250..2628

Additional Resources:

NCBI RefSeq record:
NM_011849.3
NBCI Gene record:
Nek4 (23955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025686 CCACAATCAGTAGGATAAATA pLKO.1 1331 CDS 100% 15.000 21.000 N Nek4 n/a
2 TRCN0000054772 CTGGGTGTGTAAACAGTTCAA pLKO.1 1862 CDS 100% 4.950 6.930 N Nek4 n/a
3 TRCN0000025688 GCTCTATGTCTGAACCTTCTT pLKO.1 1676 CDS 100% 4.950 6.930 N Nek4 n/a
4 TRCN0000025684 CCCTACAACTATAAGTCGGAT pLKO.1 793 CDS 100% 2.640 3.696 N Nek4 n/a
5 TRCN0000025685 GCCATTGTATCCCTCAAATAA pLKO.1 1575 CDS 100% 15.000 12.000 N Nek4 n/a
6 TRCN0000054770 CAACTCTTAGAGCAGGTGTTT pLKO.1 2479 CDS 100% 4.950 3.960 N Nek4 n/a
7 TRCN0000025687 GCCTGTCTGAGGATGAGTTAA pLKO.1 2129 CDS 100% 13.200 9.240 N Nek4 n/a
8 TRCN0000054771 CCTGAGCTGTTCTCCAACAAA pLKO.1 772 CDS 100% 5.625 3.938 N Nek4 n/a
9 TRCN0000001696 CGGCAAGCAGTATGTCATCAA pLKO.1 333 CDS 100% 4.950 3.465 N NEK4 n/a
10 TRCN0000054768 CGGTCTGCTCTACATTGTCAT pLKO.1 477 CDS 100% 4.950 3.465 N Nek4 n/a
11 TRCN0000054769 GCTTTGCATGTCATGGGTGAA pLKO.1 1198 CDS 100% 4.050 2.835 N Nek4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14849 pDONR223 64.5% 75.5% 28.5% None (many diffs) n/a
2 ccsbBroad304_14849 pLX_304 0% 75.5% 28.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471117 GTAGCGTTGCACTCCATGGACCCG pLX_317 19.8% 75.5% 28.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV