Transcript: Mouse NM_011875.4

Mus musculus proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 (Psmd13), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Psmd13 (23997)
Length:
1563
CDS:
79..1209

Additional Resources:

NCBI RefSeq record:
NM_011875.4
NBCI Gene record:
Psmd13 (23997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011875.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314108 GACGGCAATCGGAGCTCTAAA pLKO_005 423 CDS 100% 13.200 18.480 N Psmd13 n/a
2 TRCN0000066019 CCGATCCTAATGTGGCTCTTA pLKO.1 341 CDS 100% 4.950 6.930 N Psmd13 n/a
3 TRCN0000317910 CCGATCCTAATGTGGCTCTTA pLKO_005 341 CDS 100% 4.950 6.930 N Psmd13 n/a
4 TRCN0000350044 TGGGAACTGTTCTTGCTATAA pLKO_005 1323 3UTR 100% 13.200 10.560 N Psmd13 n/a
5 TRCN0000330282 CTATGATCTCTCCAGTAAATA pLKO_005 543 CDS 100% 15.000 10.500 N PSMD13 n/a
6 TRCN0000058109 CCCAAGGAGATGGTCTCATTA pLKO.1 230 CDS 100% 13.200 9.240 N PSMD13 n/a
7 TRCN0000330283 AGATGGTCTCATTAAGCTTTA pLKO_005 237 CDS 100% 10.800 7.560 N PSMD13 n/a
8 TRCN0000066021 GACACCCTGTACGCTTTCAAT pLKO.1 781 CDS 100% 5.625 3.938 N Psmd13 n/a
9 TRCN0000066020 GCTGGATTTGCAGCAGATCAA pLKO.1 1098 CDS 100% 4.950 3.465 N Psmd13 n/a
10 TRCN0000317979 GCTGGATTTGCAGCAGATCAA pLKO_005 1098 CDS 100% 4.950 3.465 N Psmd13 n/a
11 TRCN0000066022 GTTTCTATGATCTCTCCAGTA pLKO.1 539 CDS 100% 4.050 2.835 N Psmd13 n/a
12 TRCN0000349530 GTTTCTATGATCTCTCCAGTA pLKO_005 539 CDS 100% 4.050 2.835 N Psmd13 n/a
13 TRCN0000066018 GCAGGCTACAAAGGAAACCAT pLKO.1 462 CDS 100% 3.000 2.100 N Psmd13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011875.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06808 pDONR223 100% 89.9% 96.8% None (many diffs) n/a
2 ccsbBroad304_06808 pLX_304 0% 89.9% 96.8% V5 (many diffs) n/a
3 TRCN0000469537 ATTGGACTTTTTTGATTCCCAGAG pLX_317 36.9% 89.9% 96.8% V5 (many diffs) n/a
Download CSV