Transcript: Mouse NM_011931.3

Mus musculus ring finger and WD repeat domain 2 (Rfwd2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rfwd2 (26374)
Length:
5056
CDS:
113..2314

Additional Resources:

NCBI RefSeq record:
NM_011931.3
NBCI Gene record:
Rfwd2 (26374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041083 CCTTGGTATAACAGCACATTA pLKO.1 1157 CDS 100% 13.200 10.560 N Rfwd2 n/a
2 TRCN0000335746 CCTTGGTATAACAGCACATTA pLKO_005 1157 CDS 100% 13.200 10.560 N Rfwd2 n/a
3 TRCN0000235231 GAGTAGCACCAATGGGCATAG pLKO_005 751 CDS 100% 6.000 4.800 N EG667784 n/a
4 TRCN0000041086 GCTGTATCAGTTGGAGTAGTT pLKO.1 1539 CDS 100% 4.950 3.960 N Rfwd2 n/a
5 TRCN0000363790 GCTGTATCAGTTGGAGTAGTT pLKO_005 1539 CDS 100% 4.950 3.960 N Rfwd2 n/a
6 TRCN0000235227 CAGAGTTTGGAGGACAATAAT pLKO_005 602 CDS 100% 15.000 10.500 N EG667784 n/a
7 TRCN0000235230 CTCAAACAGAAGCAAAGATTT pLKO_005 698 CDS 100% 13.200 9.240 N EG667784 n/a
8 TRCN0000041084 GCAAGCCAGTTAGATGAATTT pLKO.1 1274 CDS 100% 13.200 9.240 N Rfwd2 n/a
9 TRCN0000335668 GCAAGCCAGTTAGATGAATTT pLKO_005 1274 CDS 100% 13.200 9.240 N Rfwd2 n/a
10 TRCN0000041085 GCAGTGTCTTATGCCAAGTTT pLKO.1 1919 CDS 100% 5.625 3.938 N Rfwd2 n/a
11 TRCN0000335747 GCAGTGTCTTATGCCAAGTTT pLKO_005 1919 CDS 100% 5.625 3.938 N Rfwd2 n/a
12 TRCN0000041087 CTCAACTCCTACGAGGACAAA pLKO.1 488 CDS 100% 4.950 3.465 N Rfwd2 n/a
13 TRCN0000335666 CTCAACTCCTACGAGGACAAA pLKO_005 488 CDS 100% 4.950 3.465 N Rfwd2 n/a
14 TRCN0000029723 GCTGGAGTTACAAAGAAGATT pLKO.1 1433 CDS 100% 5.625 3.375 N COP1 n/a
15 TRCN0000343445 GCTGGAGTTACAAAGAAGATT pLKO_005 1433 CDS 100% 5.625 3.375 N COP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03940 pDONR223 100% 92.4% 97.5% None (many diffs) n/a
2 ccsbBroad304_03940 pLX_304 0% 92.4% 97.5% V5 (many diffs) n/a
3 TRCN0000477822 GATACAACGGCCTAGATGTACCAA pLX_317 18.3% 92.4% 97.5% V5 (many diffs) n/a
Download CSV