Transcript: Mouse NM_012019.3

Mus musculus apoptosis-inducing factor, mitochondrion-associated 1 (Aifm1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Aifm1 (26926)
Length:
2249
CDS:
226..2064

Additional Resources:

NCBI RefSeq record:
NM_012019.3
NBCI Gene record:
Aifm1 (26926)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_012019.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114351 CGTGGAATACACAAGCACTTT pLKO.1 2073 3UTR 100% 4.950 6.930 N Aifm1 n/a
2 TRCN0000345350 CGTGGAATACACAAGCACTTT pLKO_005 2073 3UTR 100% 4.950 6.930 N Aifm1 n/a
3 TRCN0000114354 CGGTGGCAGGTTACTCATTAA pLKO.1 1347 CDS 100% 13.200 10.560 N Aifm1 n/a
4 TRCN0000345279 CGGTGGCAGGTTACTCATTAA pLKO_005 1347 CDS 100% 13.200 10.560 N Aifm1 n/a
5 TRCN0000229860 TTTGGTGGCTTCCGGGTAAAT pLKO_005 1474 CDS 100% 13.200 10.560 N AIFM1 n/a
6 TRCN0000114353 CGTCTTTAACCGAATGCCAAT pLKO.1 1962 CDS 100% 4.050 2.835 N Aifm1 n/a
7 TRCN0000345348 CGTCTTTAACCGAATGCCAAT pLKO_005 1962 CDS 100% 4.050 2.835 N Aifm1 n/a
8 TRCN0000114352 CCTTCCTCAATACCTCAGCAA pLKO.1 1251 CDS 100% 2.640 1.848 N Aifm1 n/a
9 TRCN0000345278 CCTTCCTCAATACCTCAGCAA pLKO_005 1251 CDS 100% 2.640 1.848 N Aifm1 n/a
10 TRCN0000114355 CTCTTCAACATTCATGAAGAT pLKO.1 2041 CDS 100% 0.495 0.347 N Aifm1 n/a
11 TRCN0000345349 CTCTTCAACATTCATGAAGAT pLKO_005 2041 CDS 100% 0.495 0.347 N Aifm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012019.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02089 pDONR223 100% 90.5% 92.1% None (many diffs) n/a
2 ccsbBroad304_02089 pLX_304 0% 90.5% 92.1% V5 (many diffs) n/a
3 TRCN0000467646 TACCGAATAATTTATATCCCACTC pLX_317 23.2% 90.5% 92.1% V5 (many diffs) n/a
4 ccsbBroadEn_07363 pDONR223 100% 86.7% 87.9% None (many diffs) n/a
Download CSV