Transcript: Human NM_012154.5

Homo sapiens argonaute RISC catalytic component 2 (AGO2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
AGO2 (27161)
Length:
14595
CDS:
128..2707

Additional Resources:

NCBI RefSeq record:
NM_012154.5
NBCI Gene record:
AGO2 (27161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012154.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432648 CTATGAACTCAGGGCTTTAAA pLKO_005 2998 3UTR 100% 15.000 21.000 N AGO2 n/a
2 TRCN0000433340 ATCGAACATGAGACGTCATTG pLKO_005 2803 3UTR 100% 10.800 15.120 N AGO2 n/a
3 TRCN0000007866 CAATCAAATTACAGGCCAATT pLKO.1 237 CDS 100% 10.800 15.120 N AGO2 n/a
4 TRCN0000007865 CGTCCGTGAATTTGGAATCAT pLKO.1 1306 CDS 100% 5.625 7.875 N AGO2 n/a
5 TRCN0000433524 ACAGATTCCCAAAGGGTAAAG pLKO_005 878 CDS 100% 10.800 7.560 N AGO2 n/a
6 TRCN0000009632 CAAAGGGTAAAGTTTACCAAA pLKO.1 887 CDS 100% 4.950 3.465 N Ago2 n/a
7 TRCN0000007864 CGGCAAGAAGAGATTAGCAAA pLKO.1 1250 CDS 100% 4.950 3.465 N AGO2 n/a
8 TRCN0000007867 GCACAGCCAGTAATCGAGTTT pLKO.1 806 CDS 100% 4.950 3.465 N AGO2 n/a
9 TRCN0000011203 CCAGATTTCAAACTTGGATTT pLKO.1 2863 3UTR 100% 10.800 6.480 N AGO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012154.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11851 pDONR223 100% 67.9% 68.1% None (many diffs) n/a
2 ccsbBroad304_11851 pLX_304 0% 67.9% 68.1% V5 (many diffs) n/a
3 TRCN0000468477 CTGAAGCTCCACCCAAAAACGCGC pLX_317 14.7% 67.9% 68.1% V5 (many diffs) n/a
4 ccsbBroadEn_11852 pDONR223 100% 43.8% 43.8% None 1_1446del n/a
5 ccsbBroad304_11852 pLX_304 0% 43.8% 43.8% V5 1_1446del n/a
Download CSV