Transcript: Human NM_012173.3

Homo sapiens F-box protein 25 (FBXO25), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
FBXO25 (26260)
Length:
2452
CDS:
418..1293

Additional Resources:

NCBI RefSeq record:
NM_012173.3
NBCI Gene record:
FBXO25 (26260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012173.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314574 ACGTGACACTAACGGCCAATA pLKO_005 1608 3UTR 100% 10.800 15.120 N FBXO25 n/a
2 TRCN0000004320 GTACGGAGACACACTGCATTT pLKO.1 1152 CDS 100% 10.800 15.120 N FBXO25 n/a
3 TRCN0000314573 GTACGGAGACACACTGCATTT pLKO_005 1152 CDS 100% 10.800 15.120 N FBXO25 n/a
4 TRCN0000350374 TTAGTGGGAAACATCAATATT pLKO_005 790 CDS 100% 15.000 10.500 N FBXO25 n/a
5 TRCN0000004318 CCACCACAATCCTCGCTTAAT pLKO.1 702 CDS 100% 13.200 9.240 N FBXO25 n/a
6 TRCN0000314572 CCACCACAATCCTCGCTTAAT pLKO_005 702 CDS 100% 13.200 9.240 N FBXO25 n/a
7 TRCN0000004321 GAAGTCTGTATTAGTGGGAAA pLKO.1 780 CDS 100% 4.050 2.835 N FBXO25 n/a
8 TRCN0000004319 GCCATTCTTGTCTTAGGGATT pLKO.1 1819 3UTR 100% 4.050 2.835 N FBXO25 n/a
9 TRCN0000004317 TCAGAAACATTACCCAGCGAA pLKO.1 1125 CDS 100% 2.640 1.848 N FBXO25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012173.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02942 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02942 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480232 CAAACACCTAAATTATAGCACTTG pLX_317 37.7% 100% 100% V5 n/a
Download CSV