Transcript: Human NM_012193.4

Homo sapiens frizzled class receptor 4 (FZD4), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
FZD4 (8322)
Length:
7387
CDS:
311..1924

Additional Resources:

NCBI RefSeq record:
NM_012193.4
NBCI Gene record:
FZD4 (8322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012193.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008330 CGTGTGTGATTGCCTGTTATT pLKO.1 1656 CDS 100% 13.200 10.560 N FZD4 n/a
2 TRCN0000356541 TCTCAGTATGTGCTATAATAT pLKO_005 1081 CDS 100% 15.000 10.500 N FZD4 n/a
3 TRCN0000304380 TTCTCAGTATGTGCTATAATA pLKO_005 1080 CDS 100% 15.000 10.500 N Fzd4 n/a
4 TRCN0000356464 CAGATAGCAAAGCAATCTATA pLKO_005 2352 3UTR 100% 13.200 9.240 N FZD4 n/a
5 TRCN0000356465 TTTGGAGGAAATTCTACTAAA pLKO_005 1976 3UTR 100% 13.200 9.240 N FZD4 n/a
6 TRCN0000008331 GTGGCTATGATGCTGGCTTAT pLKO.1 921 CDS 100% 10.800 7.560 N FZD4 n/a
7 TRCN0000008332 GCAGAAGTGTTCCAACAGATT pLKO.1 1822 CDS 100% 4.950 3.465 N FZD4 n/a
8 TRCN0000008333 GCCAATGTGCACAGAGAAGAT pLKO.1 619 CDS 100% 4.950 3.465 N FZD4 n/a
9 TRCN0000008329 CCCTGAATGAATTGCTAAATT pLKO.1 7221 3UTR 100% 15.000 9.000 N FZD4 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6100 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000071679 GTCATCTTGATTATGAGACTA pLKO.1 1391 CDS 100% 4.950 3.465 N Fzd4 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6100 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012193.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01889 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01889 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469245 TAGTTTTCCCTGTCTCAATACCCT pLX_317 29% 100% 100% V5 n/a
4 TRCN0000489645 GGGAAACAGGCCTTCCCGGAGGCA pLX_317 23.8% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV