Transcript: Human NM_012234.6

Homo sapiens RING1 and YY1 binding protein (RYBP), mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
RYBP (23429)
Length:
4678
CDS:
184..870

Additional Resources:

NCBI RefSeq record:
NM_012234.6
NBCI Gene record:
RYBP (23429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012234.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273636 ATTTCGCACCCTGACGATTAC pLKO_005 1033 3UTR 100% 10.800 15.120 N RYBP n/a
2 TRCN0000007945 CACCGTCATTATCACAGACTT pLKO.1 681 CDS 100% 4.950 6.930 N RYBP n/a
3 TRCN0000007944 GCTACAACAAAGACCAGCGAA pLKO.1 580 CDS 100% 2.640 2.112 N RYBP n/a
4 TRCN0000273638 ACAGTGCTGAAGCCTTTAAAT pLKO_005 284 CDS 100% 15.000 10.500 N RYBP n/a
5 TRCN0000007943 GCCAAGTATTCGTGTAAATTA pLKO.1 1721 3UTR 100% 15.000 10.500 N RYBP n/a
6 TRCN0000239843 TGGGCAACGTCACCGTCATTA pLKO_005 671 CDS 100% 13.200 9.240 N Rybp-ps n/a
7 TRCN0000315343 TGGGCAACGTCACCGTCATTA pLKO_005 671 CDS 100% 13.200 9.240 N RYBP n/a
8 TRCN0000273637 TGCACAGCAGTTGGCAGTAAC pLKO_005 648 CDS 100% 10.800 7.560 N RYBP n/a
9 TRCN0000007946 AGGAAATTAGTCCTAGTGTTA pLKO.1 470 CDS 100% 4.950 3.465 N RYBP n/a
10 TRCN0000007947 CCAAAGTCTGACATTCTGAAA pLKO.1 520 CDS 100% 4.950 3.465 N RYBP n/a
11 TRCN0000273684 CCAAAGTCTGACATTCTGAAA pLKO_005 520 CDS 100% 4.950 3.465 N RYBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012234.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07885 pDONR223 100% 99.8% 99.5% None 58G>A n/a
2 ccsbBroad304_07885 pLX_304 0% 99.8% 99.5% V5 58G>A n/a
3 TRCN0000478796 GCTGCACCCCAATCTCTGACCCTT pLX_317 56.2% 99.8% 99.5% V5 58G>A n/a
4 ccsbBroadEn_07884 pDONR223 100% 99.8% 100% None 189A>G n/a
5 ccsbBroad304_07884 pLX_304 0% 99.8% 100% V5 189A>G n/a
6 TRCN0000471677 TCTGCTGTATCACGGGGTGGGTTT pLX_317 59.6% 99.8% 100% V5 189A>G n/a
Download CSV