Transcript: Human NM_012319.4

Homo sapiens solute carrier family 39 member 6 (SLC39A6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SLC39A6 (25800)
Length:
3566
CDS:
237..2504

Additional Resources:

NCBI RefSeq record:
NM_012319.4
NBCI Gene record:
SLC39A6 (25800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012319.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365071 ATCATGACTACCATCATATTC pLKO_005 1909 CDS 100% 13.200 18.480 N SLC39A6 n/a
2 TRCN0000038482 GCCTCATGAATTAGGTGACTT pLKO.1 2147 CDS 100% 4.950 6.930 N SLC39A6 n/a
3 TRCN0000365072 CTGTACTATGCAGCGTTTAAA pLKO_005 2579 3UTR 100% 15.000 12.000 N SLC39A6 n/a
4 TRCN0000038483 CCTCTCATGAATCGGGTGTTT pLKO.1 1275 CDS 100% 4.950 3.960 N SLC39A6 n/a
5 TRCN0000376539 GATCGAACTGAAGGCTATTTA pLKO_005 1698 CDS 100% 15.000 10.500 N SLC39A6 n/a
6 TRCN0000376609 ATCATCACTCTCACCATAATC pLKO_005 616 CDS 100% 13.200 9.240 N SLC39A6 n/a
7 TRCN0000370017 GCAATTTCCACACGGCAATAT pLKO_005 381 CDS 100% 13.200 9.240 N SLC39A6 n/a
8 TRCN0000365027 TGACTTTGCTGTTCTACTAAA pLKO_005 2162 CDS 100% 13.200 9.240 N SLC39A6 n/a
9 TRCN0000370016 TTCACCGGTATTACCAGTTTA pLKO_005 2714 3UTR 100% 13.200 9.240 N SLC39A6 n/a
10 TRCN0000370059 ATGCAACAGAGTTCAACTATC pLKO_005 1084 CDS 100% 10.800 7.560 N SLC39A6 n/a
11 TRCN0000038480 CCACAGGAAGTCTACAATGAA pLKO.1 1806 CDS 100% 5.625 3.938 N SLC39A6 n/a
12 TRCN0000038479 GCCATCATCAACCAAATTGAT pLKO.1 1113 CDS 100% 0.563 0.394 N SLC39A6 n/a
13 TRCN0000038481 CGAGCATCACTCTGACCATAA pLKO.1 596 CDS 100% 10.800 7.560 N SLC39A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012319.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02854 pDONR223 100% 57.2% 57% None (many diffs) n/a
2 ccsbBroad304_02854 pLX_304 0% 57.2% 57% V5 (many diffs) n/a
3 TRCN0000471002 CCACCTAAGTCAATCTTTTAGAAT pLX_317 31.3% 57.2% 57% V5 (many diffs) n/a
Download CSV