Transcript: Human NM_012448.4

Homo sapiens signal transducer and activator of transcription 5B (STAT5B), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
STAT5B (6777)
Length:
5079
CDS:
155..2518

Additional Resources:

NCBI RefSeq record:
NM_012448.4
NBCI Gene record:
STAT5B (6777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012448.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232137 CATCAGATGCAAGCGTTATAT pLKO_005 200 CDS 100% 15.000 21.000 N STAT5B n/a
2 TRCN0000232141 GTGTCAAGGCAGATTAGTTAT pLKO_005 4918 3UTR 100% 13.200 18.480 N STAT5B n/a
3 TRCN0000222159 CGCCATATATTGTACAATGAA pLKO.1 482 CDS 100% 5.625 7.875 N STAT5B n/a
4 TRCN0000232140 TATGTCCCTGAAACGAATTAA pLKO_005 1408 CDS 100% 15.000 10.500 N STAT5B n/a
5 TRCN0000232139 TCCGCTGCATCCGCCATATAT pLKO_005 471 CDS 100% 15.000 10.500 N STAT5B n/a
6 TRCN0000222158 CCACCCTAATTTGACATCAAA pLKO.1 3543 3UTR 100% 5.625 3.938 N STAT5B n/a
7 TRCN0000222161 CCAGTTCAGTGTTGGTGGAAA pLKO.1 1492 CDS 100% 4.950 3.465 N STAT5B n/a
8 TRCN0000222160 CTACTCATTAACAAGCCAGAT pLKO.1 1970 CDS 100% 4.050 2.835 N STAT5B n/a
9 TRCN0000012556 TCTTGATAATCCACAGGAGAA pLKO.1 295 CDS 100% 4.050 2.835 N Stat5b n/a
10 TRCN0000222162 CCTTCATCAGATGCAAGCGTT pLKO.1 196 CDS 100% 2.640 1.848 N STAT5B n/a
11 TRCN0000232138 CCATTGAGGTGCGGCATTATT pLKO_005 234 CDS 100% 15.000 9.000 N STAT5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012448.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07008 pDONR223 100% 87% 91% None (many diffs) n/a
2 ccsbBroad304_07008 pLX_304 0% 87% 91% V5 (many diffs) n/a
3 TRCN0000473086 GCAGCTAGCTCAGGACTTTAACCG pLX_317 15% 87% 91% V5 (many diffs) n/a
4 ccsbBroadEn_11162 pDONR223 100% 49.5% 49.4% None 1170_2361delinsG n/a
5 ccsbBroad304_11162 pLX_304 0% 49.5% 49.4% V5 1170_2361delinsG n/a
6 TRCN0000473930 GGACCACCCACTCAATCTATTGCG pLX_317 45.4% 49.5% 49.4% V5 1170_2361delinsG n/a
Download CSV