Transcript: Human NM_012449.3

Homo sapiens STEAP family member 1 (STEAP1), mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Homo sapiens (human)
Gene:
STEAP1 (26872)
Length:
1219
CDS:
107..1126

Additional Resources:

NCBI RefSeq record:
NM_012449.3
NBCI Gene record:
STEAP1 (26872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158850 GCACAATACACGCATTGATTT pLKO.1 900 CDS 100% 13.200 10.560 N STEAP1 n/a
2 TRCN0000160657 CTGGAATAAGTGGATAGATAT pLKO.1 925 CDS 100% 13.200 9.240 N STEAP1 n/a
3 TRCN0000158955 GAAGAAGACGATTATTTGCAT pLKO.1 173 CDS 100% 3.000 2.100 N STEAP1 n/a
4 TRCN0000281169 GAAGAAGACGATTATTTGCAT pLKO_005 173 CDS 100% 3.000 2.100 N STEAP1 n/a
5 TRCN0000159419 GCAATTGTCCAACTTCATAAT pLKO.1 515 CDS 100% 13.200 7.920 N STEAP1 n/a
6 TRCN0000281237 GCAATTGTCCAACTTCATAAT pLKO_005 515 CDS 100% 13.200 7.920 N STEAP1 n/a
7 TRCN0000162020 GCCTGGAATAAGTGGATAGAT pLKO.1 923 CDS 100% 5.625 3.375 N STEAP1 n/a
8 TRCN0000159569 CCAACTTCATAATGGAACCAA pLKO.1 523 CDS 100% 3.000 1.800 N STEAP1 n/a
9 TRCN0000376743 CAGTGGCACTTGCCAATTAAA pLKO_005 314 CDS 100% 15.000 7.500 Y STEAP1B n/a
10 TRCN0000376666 GCTGTACTGCATGCAATTTAT pLKO_005 620 CDS 100% 15.000 7.500 Y STEAP1B n/a
11 TRCN0000365784 TGGAGAGAATTTCACTATATT pLKO_005 845 CDS 100% 15.000 7.500 Y STEAP1B n/a
12 TRCN0000370988 CTGTTGGCTGTGACATCTATT pLKO_005 800 CDS 100% 13.200 6.600 Y STEAP1B n/a
13 TRCN0000365781 TCATAATGGAACCAAGTATAA pLKO_005 529 CDS 100% 13.200 6.600 Y STEAP1B n/a
14 TRCN0000370923 CACTCTCTTGGCATTGGTTTA pLKO_005 475 CDS 100% 10.800 5.400 Y STEAP1B n/a
15 TRCN0000370986 TTTCCACATTGGTTGGATAAG pLKO_005 554 CDS 100% 10.800 5.400 Y STEAP1B n/a
16 TRCN0000161811 CCTGGATTGAGCATGATGTTT pLKO.1 726 CDS 100% 5.625 2.813 Y STEAP1 n/a
17 TRCN0000281175 CCTGGATTGAGCATGATGTTT pLKO_005 726 CDS 100% 5.625 2.813 Y STEAP1 n/a
18 TRCN0000161064 GAGGGAAGTAATTCACCCTTT pLKO.1 379 CDS 100% 4.050 2.025 Y STEAP1 n/a
19 TRCN0000281236 GAGGGAAGTAATTCACCCTTT pLKO_005 379 CDS 100% 4.050 2.025 Y STEAP1 n/a
20 TRCN0000164986 GCTGATGAATTTGACTGCCCT pLKO.1 260 CDS 100% 0.660 0.330 Y STEAP1 n/a
21 TRCN0000297943 GCTGATGAATTTGACTGCCCT pLKO_005 260 CDS 100% 0.660 0.330 Y STEAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09911 pDONR223 100% 69.9% 66.2% None (many diffs) n/a
2 ccsbBroad304_09911 pLX_304 0% 69.9% 66.2% V5 (many diffs) n/a
3 TRCN0000465389 TCACCAAACTGTGCCACGGGTCGA pLX_317 45.2% 69.9% 66.2% V5 (many diffs) n/a
Download CSV