Transcript: Human NM_012463.4

Homo sapiens ATPase H+ transporting V0 subunit a2 (ATP6V0A2), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ATP6V0A2 (23545)
Length:
6507
CDS:
214..2784

Additional Resources:

NCBI RefSeq record:
NM_012463.4
NBCI Gene record:
ATP6V0A2 (23545)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043497 CGGAGTGGCTACACACTTATA pLKO.1 2266 CDS 100% 13.200 18.480 N ATP6V0A2 n/a
2 TRCN0000043493 CCCAGCATTCTGATTGAATTT pLKO.1 2074 CDS 100% 13.200 9.240 N ATP6V0A2 n/a
3 TRCN0000043496 GCCACAAGGTTAAGAAGATAT pLKO.1 917 CDS 100% 13.200 9.240 N ATP6V0A2 n/a
4 TRCN0000043495 CCCAGACTAAATCAGTCACAA pLKO.1 1516 CDS 100% 4.950 3.465 N ATP6V0A2 n/a
5 TRCN0000043494 CGTAAGTTCTTTCCAAAGAAA pLKO.1 342 CDS 100% 0.563 0.394 N ATP6V0A2 n/a
6 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5843 3UTR 100% 4.950 2.475 Y n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5916 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5916 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012463.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07897 pDONR223 100% 99.8% 100% None 426T>C;471T>C;1515T>C n/a
2 ccsbBroad304_07897 pLX_304 0% 99.8% 100% V5 426T>C;471T>C;1515T>C n/a
3 TRCN0000467150 GCTTCATAGTAAGAAGGTACGTCA pLX_317 12.3% 99.8% 100% V5 426T>C;471T>C;1515T>C n/a
Download CSV