Transcript: Human NM_013286.5

Homo sapiens RNA binding motif protein 15B (RBM15B), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RBM15B (29890)
Length:
6624
CDS:
116..2788

Additional Resources:

NCBI RefSeq record:
NM_013286.5
NBCI Gene record:
RBM15B (29890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013286.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137051 CCATTAAGATAGGCTATGGCA pLKO.1 1332 CDS 100% 0.750 1.050 N RBM15B n/a
2 TRCN0000138284 CGAAGGGCCTTCGAGAAATAT pLKO.1 1175 CDS 100% 15.000 12.000 N RBM15B n/a
3 TRCN0000138935 GAATGGGCTTCTGGTGTTGAA pLKO.1 2281 CDS 100% 4.950 3.960 N RBM15B n/a
4 TRCN0000135036 CTTCGAGAAATATGGCATCAT pLKO.1 1183 CDS 100% 4.950 3.465 N RBM15B n/a
5 TRCN0000134657 GAAGAAGAACACATGGTGATA pLKO.1 2744 CDS 100% 4.950 3.465 N RBM15B n/a
6 TRCN0000138870 GCGCAACCTCTTCATTGGTAA pLKO.1 1123 CDS 100% 4.950 3.465 N RBM15B n/a
7 TRCN0000138263 CTAAGGACATTGGGCAAGCTA pLKO.1 2723 CDS 100% 3.000 2.100 N RBM15B n/a
8 TRCN0000137491 GCAAGCTAGAAGAAGAACACA pLKO.1 2736 CDS 100% 3.000 2.100 N RBM15B n/a
9 TRCN0000137102 CAAAGGAGATAGCTTTGCCTA pLKO.1 1465 CDS 100% 0.264 0.185 N RBM15B n/a
10 TRCN0000138714 GAACCTGGTCTCCTACTTGAA pLKO.1 2581 CDS 100% 4.950 2.970 N RBM15B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013286.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11910 pDONR223 100% 63.2% 63.1% None 1_981del;1778G>A n/a
2 ccsbBroad304_11910 pLX_304 0% 63.2% 63.1% V5 1_981del;1778G>A n/a
3 TRCN0000481366 CACGTGGAATAGTAGCTCACGGGT pLX_317 27% 63.2% 63.1% V5 1_981del;1778G>A n/a
4 ccsbBroadEn_15808 pDONR223 0% 46.9% 46.9% None 1_1416del n/a
5 ccsbBroad304_15808 pLX_304 0% 46.9% 46.9% V5 1_1416del n/a
6 TRCN0000491732 TGCCCGGGACTGTGCATATCAGAG pLX_317 29.2% 46.9% 46.9% V5 1_1416del n/a
Download CSV