Transcript: Mouse NM_013831.4

Mus musculus proline-serine-threonine phosphatase-interacting protein 2 (Pstpip2), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pstpip2 (19201)
Length:
3138
CDS:
169..1173

Additional Resources:

NCBI RefSeq record:
NM_013831.4
NBCI Gene record:
Pstpip2 (19201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093460 CCGTAAGAACTGCAAGGAGTT pLKO.1 261 CDS 100% 4.050 5.670 N Pstpip2 n/a
2 TRCN0000093459 CCTTGTGGCATGACAGGAAAT pLKO.1 2852 3UTR 100% 10.800 7.560 N Pstpip2 n/a
3 TRCN0000093461 GCACTGTGGTTGCATCTGAAT pLKO.1 856 CDS 100% 4.950 3.465 N Pstpip2 n/a
4 TRCN0000093463 CGAATCAACTTCTTCCGGAAT pLKO.1 835 CDS 100% 4.050 2.835 N Pstpip2 n/a
5 TRCN0000093462 GCAAATGACGAGATGTATGAA pLKO.1 898 CDS 100% 5.625 3.938 N Pstpip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14010 pDONR223 100% 75.1% 60.9% None (many diffs) n/a
2 ccsbBroad304_14010 pLX_304 0% 75.1% 60.9% V5 (many diffs) n/a
3 TRCN0000465958 AAGCTGAGTCGGGCCAGGGGTGCC pLX_317 40.6% 75.1% 60.9% V5 (many diffs) n/a
Download CSV