Transcript: Human NM_013939.2

Homo sapiens olfactory receptor family 10 subfamily H member 2 (OR10H2), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
OR10H2 (26538)
Length:
1029
CDS:
21..968

Additional Resources:

NCBI RefSeq record:
NM_013939.2
NBCI Gene record:
OR10H2 (26538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009281 GCCTGTGGAAATAATGTACCA pLKO.1 582 CDS 100% 2.640 2.112 N OR10H2 n/a
2 TRCN0000009280 TCTCACCTTATTGTGGTCATT pLKO.1 750 CDS 100% 4.950 3.465 N OR10H2 n/a
3 TRCN0000357777 GACTTTCTGTGGATCCCATGA pLKO_005 518 CDS 100% 4.050 2.835 N OR10H2 n/a
4 TRCN0000009283 TCCAACTGACTTTCTGTGGAT pLKO.1 511 CDS 100% 2.640 1.848 N OR10H2 n/a
5 TRCN0000357779 TGTGGAAATAATGTACCAGCT pLKO_005 585 CDS 100% 2.160 1.512 N OR10H2 n/a
6 TRCN0000357778 ACCTGTGCCTCTCACCTTATT pLKO_005 741 CDS 100% 13.200 7.920 N OR10H2 n/a
7 TRCN0000357709 TCATTGTGCACTATGGCTTTG pLKO_005 766 CDS 100% 6.000 3.600 N OR10H2 n/a
8 TRCN0000009282 CCGACATCTTGAAGATCCCTT pLKO.1 691 CDS 100% 2.640 1.584 N OR10H2 n/a
9 TRCN0000357708 TCTGCTGAAGGTCGGAACAAG pLKO_005 711 CDS 100% 4.950 2.475 Y OR10H1 n/a
10 TRCN0000357706 TGCGCTACAACGTGCTCATGA pLKO_005 409 CDS 100% 4.950 2.475 Y OR10H1 n/a
11 TRCN0000011786 GTTCCTGCTGATGTACCTGTT pLKO.1 110 CDS 100% 4.050 2.025 Y OR10H1 n/a
12 TRCN0000009284 CCAGTCAGATGTTCTTCTCCT pLKO.1 313 CDS 100% 2.640 1.320 Y OR10H2 n/a
13 TRCN0000009278 GATGTTCTTCTCCTTCAGCTT pLKO.1 320 CDS 100% 2.640 1.320 Y OR10H1 n/a
14 TRCN0000187492 GATGTTCTTCTCCTTCAGCTT pLKO.1 320 CDS 100% 2.640 1.320 Y OR10H5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08026 pDONR223 100% 99.7% 100% None 114G>A;321C>T n/a
2 ccsbBroad304_08026 pLX_304 0% 99.7% 100% V5 114G>A;321C>T n/a
3 TRCN0000469165 CTCTACGTTAAGCCTTTGGCGTCT pLX_317 32.6% 99.7% 100% V5 114G>A;321C>T n/a
4 ccsbBroadEn_08027 pDONR223 100% 88.6% 86.7% None (many diffs) n/a
5 ccsbBroad304_08027 pLX_304 0% 88.6% 86.7% V5 (many diffs) n/a
6 TRCN0000469520 ACGGAGTGAACTCCAGACTTATCC pLX_317 20.1% 88.6% 86.7% V5 (many diffs) n/a
Download CSV