Transcript: Human NM_013940.3

Homo sapiens olfactory receptor family 10 subfamily H member 1 (OR10H1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
OR10H1 (26539)
Length:
1124
CDS:
90..1046

Additional Resources:

NCBI RefSeq record:
NM_013940.3
NBCI Gene record:
OR10H1 (26539)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013940.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357707 TGGCTTTGCCTCCGTCATTTA pLKO_005 848 CDS 100% 13.200 6.600 Y OR10H1 n/a
2 TRCN0000357775 ACACAAGGAGATCCACCATTT pLKO_005 599 CDS 100% 10.800 5.400 Y OR10H1 n/a
3 TRCN0000357708 TCTGCTGAAGGTCGGAACAAG pLKO_005 780 CDS 100% 4.950 2.475 Y OR10H1 n/a
4 TRCN0000357706 TGCGCTACAACGTGCTCATGA pLKO_005 478 CDS 100% 4.950 2.475 Y OR10H1 n/a
5 TRCN0000009277 GCCATCTTGAAGATCCCTTCT pLKO.1 762 CDS 100% 4.050 2.025 Y OR10H1 n/a
6 TRCN0000011786 GTTCCTGCTGATGTACCTGTT pLKO.1 179 CDS 100% 4.050 2.025 Y OR10H1 n/a
7 TRCN0000009284 CCAGTCAGATGTTCTTCTCCT pLKO.1 382 CDS 100% 2.640 1.320 Y OR10H2 n/a
8 TRCN0000009278 GATGTTCTTCTCCTTCAGCTT pLKO.1 389 CDS 100% 2.640 1.320 Y OR10H1 n/a
9 TRCN0000187492 GATGTTCTTCTCCTTCAGCTT pLKO.1 389 CDS 100% 2.640 1.320 Y OR10H5 n/a
10 TRCN0000009276 CGTCATTTACCTGAAGCCCAA pLKO.1 860 CDS 100% 2.160 1.080 Y OR10H1 n/a
11 TRCN0000189420 CGTCATTTACCTGAAGCCCAA pLKO.1 860 CDS 100% 2.160 1.080 Y OR10H5 n/a
12 TRCN0000009279 CCTCGCCTTCTGTGGACACAA pLKO.1 584 CDS 100% 1.650 0.825 Y OR10H1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013940.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08027 pDONR223 100% 99.8% 100% None 393C>T n/a
2 ccsbBroad304_08027 pLX_304 0% 99.8% 100% V5 393C>T n/a
3 TRCN0000469520 ACGGAGTGAACTCCAGACTTATCC pLX_317 20.1% 99.8% 100% V5 393C>T n/a
4 ccsbBroadEn_08026 pDONR223 100% 88.5% 86.7% None (many diffs) n/a
5 ccsbBroad304_08026 pLX_304 0% 88.5% 86.7% V5 (many diffs) n/a
6 TRCN0000469165 CTCTACGTTAAGCCTTTGGCGTCT pLX_317 32.6% 88.5% 86.7% V5 (many diffs) n/a
Download CSV