Transcript: Human NM_014110.5

Homo sapiens protein phosphatase 1 regulatory subunit 8 (PPP1R8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PPP1R8 (5511)
Length:
2340
CDS:
55..1110

Additional Resources:

NCBI RefSeq record:
NM_014110.5
NBCI Gene record:
PPP1R8 (5511)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014110.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218076 TCCCACTTTCTAGGATCATTT pLKO_005 1390 3UTR 100% 13.200 18.480 N PPP1R8 n/a
2 TRCN0000226411 TGCCGTCAGCAGTGAACATGA pLKO_005 974 CDS 100% 4.950 6.930 N PPP1R8 n/a
3 TRCN0000226412 TATAACCCTGAAGCTGTAAAT pLKO_005 1018 CDS 100% 13.200 10.560 N PPP1R8 n/a
4 TRCN0000226413 TTCCTTGCTGATTTGATATTT pLKO_005 1095 CDS 100% 15.000 10.500 N PPP1R8 n/a
5 TRCN0000002474 CCACACCTTCCTTGCTGATTT pLKO.1 1088 CDS 100% 13.200 9.240 N PPP1R8 n/a
6 TRCN0000226410 TTGCCCATGCCATACCCAAAC pLKO_005 922 CDS 100% 6.000 4.200 N PPP1R8 n/a
7 TRCN0000002473 GAACATGAACCCTGCACCAAA pLKO.1 987 CDS 100% 4.950 3.465 N PPP1R8 n/a
8 TRCN0000002476 TGTAAATGAACCCAAGAAGAA pLKO.1 1032 CDS 100% 4.950 3.465 N PPP1R8 n/a
9 TRCN0000002475 CATAGGAGACAAAGTTAGGAA pLKO.1 2052 3UTR 100% 3.000 2.100 N PPP1R8 n/a
10 TRCN0000002472 TGAAGCTGTAAATGAACCCAA pLKO.1 1026 CDS 100% 2.640 1.848 N PPP1R8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014110.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01261 pDONR223 100% 59.5% 59.5% None 1_426del n/a
2 ccsbBroad304_01261 pLX_304 0% 59.5% 59.5% V5 1_426del n/a
3 TRCN0000465265 TCGCCCCGCTTATTGGGACAGCGC pLX_317 39.2% 59.5% 59.5% V5 1_426del n/a
Download CSV