Transcript: Human NM_014184.4

Homo sapiens cornichon family AMPA receptor auxiliary protein 4 (CNIH4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CNIH4 (29097)
Length:
4096
CDS:
47..466

Additional Resources:

NCBI RefSeq record:
NM_014184.4
NBCI Gene record:
CNIH4 (29097)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014184.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127498 CCTCTCGGTCTACTTCATAAT pLKO.1 100 CDS 100% 13.200 18.480 N CNIH4 n/a
2 TRCN0000338942 CCTCTCGGTCTACTTCATAAT pLKO_005 100 CDS 100% 13.200 18.480 N CNIH4 n/a
3 TRCN0000184650 GAGGAGCCAGAGACTTCTTAA pLKO.1 515 3UTR 100% 13.200 9.240 N CNIH4 n/a
4 TRCN0000183590 GATCCAACAGAAATACACAAT pLKO.1 335 CDS 100% 4.950 3.465 N CNIH4 n/a
5 TRCN0000339012 GATCCAACAGAAATACACAAT pLKO_005 335 CDS 100% 4.950 3.465 N CNIH4 n/a
6 TRCN0000149322 GTCACACATGAAAGAAGCCAT pLKO.1 370 CDS 100% 2.640 1.848 N CNIH4 n/a
7 TRCN0000339013 GTCACACATGAAAGAAGCCAT pLKO_005 370 CDS 100% 2.640 1.848 N CNIH4 n/a
8 TRCN0000129451 GAGTGGTAACATGGGAGTGTT pLKO.1 313 CDS 100% 4.950 2.970 N CNIH4 n/a
9 TRCN0000339011 GAGTGGTAACATGGGAGTGTT pLKO_005 313 CDS 100% 4.950 2.970 N CNIH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014184.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08111 pDONR223 100% 99.7% 99.2% None 14T>A n/a
2 ccsbBroad304_08111 pLX_304 0% 99.7% 99.2% V5 14T>A n/a
3 TRCN0000471048 TCACCACTGCGTTAATACACGGCA pLX_317 83.9% 99.7% 99.2% V5 14T>A n/a
Download CSV