Transcript: Human NM_014306.5

Homo sapiens RNA 2',3'-cyclic phosphate and 5'-OH ligase (RTCB), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RTCB (51493)
Length:
2019
CDS:
92..1609

Additional Resources:

NCBI RefSeq record:
NM_014306.5
NBCI Gene record:
RTCB (51493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014306.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075142 TCTTAGACAAATTGGCAGATA pLKO.1 1434 CDS 100% 4.950 6.930 N RTCB n/a
2 TRCN0000075139 CCGCTTGCTAAGAACCAATTT pLKO.1 463 CDS 100% 13.200 10.560 N RTCB n/a
3 TRCN0000290259 CCGCTTGCTAAGAACCAATTT pLKO_005 463 CDS 100% 13.200 10.560 N RTCB n/a
4 TRCN0000296540 GGAATTGTTCATCGATCTATT pLKO_005 320 CDS 100% 13.200 10.560 N RTCB n/a
5 TRCN0000296541 AGAGGCTCCTGAGTCCTATAA pLKO_005 1498 CDS 100% 13.200 9.240 N RTCB n/a
6 TRCN0000075140 CCTGATGACTTGGACCTACAT pLKO.1 1109 CDS 100% 4.950 3.465 N RTCB n/a
7 TRCN0000290324 CCTGATGACTTGGACCTACAT pLKO_005 1109 CDS 100% 4.950 3.465 N RTCB n/a
8 TRCN0000075138 CCTTGGTTGTTCCACAGAGTT pLKO.1 1845 3UTR 100% 4.950 3.465 N RTCB n/a
9 TRCN0000119951 CCAAGCTATGTTTGACCACAT pLKO.1 523 CDS 100% 4.050 2.835 N Rtcb n/a
10 TRCN0000075141 GCCATGAAACAGATTGGCAAT pLKO.1 284 CDS 100% 4.050 2.835 N RTCB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014306.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15844 pDONR223 0% 99.9% 100% None 1044C>T n/a
2 ccsbBroad304_15844 pLX_304 0% 99.9% 100% V5 1044C>T n/a
3 TRCN0000468343 GTTCTTAATCACTCCACCAAGGAC pLX_317 32.4% 99.9% 100% V5 1044C>T n/a
4 ccsbBroadEn_15843 pDONR223 0% 99.8% 100% None 66C>T;603G>A n/a
5 ccsbBroad304_15843 pLX_304 0% 99.8% 100% V5 66C>T;603G>A n/a
6 TRCN0000472919 GCCGAACCTCGGAGATTTTCGCGG pLX_317 34% 99.8% 100% V5 66C>T;603G>A;1377C>T n/a
7 ccsbBroadEn_08298 pDONR223 100% 99.8% 99.8% None 4A>C;603G>A n/a
8 ccsbBroad304_08298 pLX_304 0% 99.8% 99.8% V5 4A>C;603G>A n/a
9 TRCN0000478865 ACTGTGATCAAAACATTAACCTTA pLX_317 24.8% 99.8% 99.8% V5 4A>C;603G>A n/a
Download CSV