Transcript: Human NM_014357.5

Homo sapiens late cornified envelope 2B (LCE2B), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
LCE2B (26239)
Length:
608
CDS:
55..387

Additional Resources:

NCBI RefSeq record:
NM_014357.5
NBCI Gene record:
LCE2B (26239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014357.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160372 CTCTTTGGACAGAATGTTTAA pLKO.1 404 3UTR 100% 13.200 9.240 N LCE2B n/a
2 TRCN0000159942 GAACTCTTTGGACAGAATGTT pLKO.1 401 3UTR 100% 5.625 3.938 N LCE2B n/a
3 TRCN0000419454 ATGTTTAAGAACCTCCTACAG pLKO_005 417 3UTR 100% 4.050 2.835 N LCE2B n/a
4 TRCN0000163888 CAGCCTGATGCTTAACCCTTT pLKO.1 435 3UTR 100% 4.050 2.835 N LCE2B n/a
5 TRCN0000159882 GAAGAACTCTTTGGACAGAAT pLKO.1 398 3UTR 100% 4.950 2.970 N LCE2B n/a
6 TRCN0000438064 TGCTGACCTGGGCTAAGAAGA pLKO_005 382 CDS 100% 4.950 2.970 N LCE2B n/a
7 TRCN0000162702 CTGATGCTTAACCCTTTCCAT pLKO.1 439 3UTR 100% 3.000 1.800 N LCE2B n/a
8 TRCN0000179994 CTACAGCCTGATGCTTAACTA pLKO.1 432 3UTR 100% 5.625 2.813 Y LCE2D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014357.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15312 pDONR223 57.5% 96.3% 94.5% None (many diffs) n/a
2 ccsbBroad304_15312 pLX_304 0% 96.3% 94.5% V5 (many diffs) n/a
3 ccsbBroadEn_15311 pDONR223 68% 86.6% 84.5% None (many diffs) n/a
4 ccsbBroad304_15311 pLX_304 0% 86.6% 84.5% V5 (many diffs) n/a
5 TRCN0000472237 AATCACACCAAATATCAACTATAT pLX_317 100% 42.4% 42.7% V5 (many diffs) n/a
Download CSV