Transcript: Human NM_014413.4

Homo sapiens eukaryotic translation initiation factor 2 alpha kinase 1 (EIF2AK1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
EIF2AK1 (27102)
Length:
4411
CDS:
93..1985

Additional Resources:

NCBI RefSeq record:
NM_014413.4
NBCI Gene record:
EIF2AK1 (27102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014413.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196736 GTACAATGCTTCGTTGTATTT pLKO.1 2053 3UTR 100% 1.320 1.848 N EIF2AK1 n/a
2 TRCN0000010233 GTACACCACCAATTTAGTCAT pLKO.1 1010 CDS 100% 4.950 3.960 N EIF2AK1 n/a
3 TRCN0000194754 CAGAGAGCAATGTGGTGTTAA pLKO.1 881 CDS 100% 13.200 9.240 N EIF2AK1 n/a
4 TRCN0000195265 CAGAGCTATTACTCACTTAAT pLKO.1 455 CDS 100% 13.200 9.240 N EIF2AK1 n/a
5 TRCN0000010231 AGCTACTTTGCCAGACGTTTA pLKO.1 367 CDS 100% 10.800 7.560 N EIF2AK1 n/a
6 TRCN0000196368 GCAGAAGTTCTAACAGGTTTA pLKO.1 1692 CDS 100% 10.800 7.560 N EIF2AK1 n/a
7 TRCN0000010230 GAATTGGTAGAAGGTGTGTTT pLKO.1 1365 CDS 100% 4.950 3.465 N EIF2AK1 n/a
8 TRCN0000196718 GCTCAACTTCTTAACAGTGTA pLKO.1 2478 3UTR 100% 4.950 3.465 N EIF2AK1 n/a
9 TRCN0000010229 GGATTGGATAGTCGAGAGAAA pLKO.1 1268 CDS 100% 4.950 3.465 N EIF2AK1 n/a
10 TRCN0000010232 GAGCTGCCATTGAGTTGCCAT pLKO.1 829 CDS 100% 2.640 1.848 N EIF2AK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014413.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15040 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15040 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000488611 CGATCCGCAAGACCTGTATATGAG pLX_317 16.8% 100% 100% V5 (not translated due to prior stop codon) n/a
4 ccsbBroadEn_08054 pDONR223 100% 99.8% 99.8% None 918G>A;1877A>C n/a
5 ccsbBroad304_08054 pLX_304 0% 99.8% 99.8% V5 918G>A;1877A>C n/a
6 TRCN0000467819 TACCCCACCAGTGGGTCCTTGTAA pLX_317 13.6% 99.8% 99.8% V5 918G>A;1877A>C n/a
Download CSV