Transcript: Human NM_014519.4

Homo sapiens zinc finger protein 232 (ZNF232), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ZNF232 (7775)
Length:
2094
CDS:
670..2004

Additional Resources:

NCBI RefSeq record:
NM_014519.4
NBCI Gene record:
ZNF232 (7775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014519.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369739 GCTACTGACACCTCTACATTT pLKO_005 1417 CDS 100% 13.200 18.480 N ZNF232 n/a
2 TRCN0000021730 CCACTCTACCAGTCAAGAGAT pLKO.1 879 CDS 100% 4.950 6.930 N ZNF232 n/a
3 TRCN0000021731 CCACCCATTACTGAAGTGGAA pLKO.1 1372 CDS 100% 2.640 3.696 N ZNF232 n/a
4 TRCN0000364812 CAAAGAGTGAACAGGTATATT pLKO_005 1286 CDS 100% 15.000 10.500 N ZNF232 n/a
5 TRCN0000369669 ATGGTGCTCAGAGCTCATTAG pLKO_005 1944 CDS 100% 10.800 7.560 N ZNF232 n/a
6 TRCN0000376431 TAGGATGGCTGTATCACTAAC pLKO_005 747 CDS 100% 10.800 7.560 N ZNF232 n/a
7 TRCN0000021729 GCCCAAGGACAAAGGATCATT pLKO.1 1344 CDS 100% 5.625 3.938 N ZNF232 n/a
8 TRCN0000021732 GCAGATGGTTGTCATCCATAA pLKO.1 1530 CDS 100% 10.800 6.480 N ZNF232 n/a
9 TRCN0000021733 GATGATGATGATGGGACCAAA pLKO.1 813 CDS 100% 4.950 2.970 N ZNF232 n/a
10 TRCN0000369741 GCCTTTAGTCAAAGCTCATAT pLKO_005 1852 CDS 100% 13.200 6.600 Y ZNF232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014519.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11241 pDONR223 100% 93.9% 93.9% None 1_81del n/a
2 ccsbBroad304_11241 pLX_304 0% 93.9% 93.9% V5 1_81del n/a
3 TRCN0000479782 ATACTTCAAAAAGAAATTGAACCG pLX_317 28.7% 93.9% 93.9% V5 1_81del n/a
Download CSV