Transcript: Human NM_014655.4

Homo sapiens solute carrier family 25 member 44 (SLC25A44), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SLC25A44 (9673)
Length:
3467
CDS:
158..1102

Additional Resources:

NCBI RefSeq record:
NM_014655.4
NBCI Gene record:
SLC25A44 (9673)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014655.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128218 CAAGAAGAAGTTCTACGTGTT pLKO.1 205 CDS 100% 4.050 5.670 N SLC25A44 n/a
2 TRCN0000285521 ACCGAGGGTTCCTGGTCAATA pLKO_005 378 CDS 100% 13.200 10.560 N SLC25A44 n/a
3 TRCN0000127997 GCCAGAGTAACACAGTCAAAT pLKO.1 471 CDS 100% 13.200 10.560 N SLC25A44 n/a
4 TRCN0000276297 GCCAGAGTAACACAGTCAAAT pLKO_005 471 CDS 100% 13.200 10.560 N SLC25A44 n/a
5 TRCN0000285519 AGTGTTATGTCACCACTTATG pLKO_005 420 CDS 100% 10.800 7.560 N SLC25A44 n/a
6 TRCN0000129598 CAGCCAGAGTAACACAGTCAA pLKO.1 469 CDS 100% 4.950 3.465 N SLC25A44 n/a
7 TRCN0000127598 CCAGGAATGTTCACATCCAAA pLKO.1 2773 3UTR 100% 4.950 3.465 N SLC25A44 n/a
8 TRCN0000276298 CCAGGAATGTTCACATCCAAA pLKO_005 2773 3UTR 100% 4.950 3.465 N SLC25A44 n/a
9 TRCN0000131005 CATTGTCATTGTGGTGGGCTA pLKO.1 1024 CDS 100% 2.160 1.512 N SLC25A44 n/a
10 TRCN0000276296 GGCTTCACTGCTTACCTATAT pLKO_005 718 CDS 100% 13.200 7.920 N SLC25A44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014655.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02224 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02224 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466930 TCTTGAACCTCGAGATTATGACTC pLX_317 45% 100% 100% V5 n/a
Download CSV