Transcript: Human NM_014679.5

Homo sapiens centrosomal protein 57 (CEP57), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CEP57 (9702)
Length:
3141
CDS:
202..1704

Additional Resources:

NCBI RefSeq record:
NM_014679.5
NBCI Gene record:
CEP57 (9702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014679.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145516 GCAGGATGACTCAATGTTAAA pLKO.1 1860 3UTR 100% 13.200 18.480 N CEP57 n/a
2 TRCN0000141011 CCTTCGGATAAGCCTTTCCTT pLKO.1 319 CDS 100% 3.000 4.200 N CEP57 n/a
3 TRCN0000278858 CCTTCGGATAAGCCTTTCCTT pLKO_005 319 CDS 100% 3.000 4.200 N CEP57 n/a
4 TRCN0000122199 GATCGAGTCATCAACAGTATT pLKO.1 1171 CDS 100% 13.200 10.560 N CEP57 n/a
5 TRCN0000278924 GATCGAGTCATCAACAGTATT pLKO_005 1171 CDS 100% 13.200 10.560 N CEP57 n/a
6 TRCN0000141796 GCTGAGCCATCAAGGTCTAAT pLKO.1 256 CDS 100% 13.200 10.560 N CEP57 n/a
7 TRCN0000297573 GCTGAGCCATCAAGGTCTAAT pLKO_005 256 CDS 100% 13.200 10.560 N CEP57 n/a
8 TRCN0000143009 CGGCATTCTTCATCTCCATAT pLKO.1 289 CDS 100% 10.800 8.640 N CEP57 n/a
9 TRCN0000278923 CGGCATTCTTCATCTCCATAT pLKO_005 289 CDS 100% 10.800 8.640 N CEP57 n/a
10 TRCN0000121576 CGACAACATGATCAAACACAT pLKO.1 724 CDS 100% 4.950 3.960 N CEP57 n/a
11 TRCN0000122750 CCAGGTCTCATACTCACTTAT pLKO.1 1775 3UTR 100% 13.200 9.240 N CEP57 n/a
12 TRCN0000143673 GAGTGTGAATTGGAGGCATTA pLKO.1 1393 CDS 100% 10.800 7.560 N CEP57 n/a
13 TRCN0000144105 CAGATACAAGAAAGGGAGAAT pLKO.1 532 CDS 100% 4.950 3.465 N CEP57 n/a
14 TRCN0000278860 CAGATACAAGAAAGGGAGAAT pLKO_005 532 CDS 100% 4.950 3.465 N CEP57 n/a
15 TRCN0000142782 CAGGCAGAAGAAAGTGTGAAA pLKO.1 466 CDS 100% 4.950 3.465 N CEP57 n/a
16 TRCN0000144880 GATCTTCTTGAACAGGAGTAT pLKO.1 769 CDS 100% 4.950 3.465 N CEP57 n/a
17 TRCN0000144002 CAGTTATTGAAGGACATGCAA pLKO.1 1636 CDS 100% 3.000 2.100 N CEP57 n/a
18 TRCN0000424830 ATTGGAATACATGCGAAATAT pLKO_005 639 CDS 100% 15.000 9.000 N Cep57 n/a
19 TRCN0000121760 CAGACTTTACAGGATGAATTT pLKO.1 1294 CDS 100% 13.200 7.920 N CEP57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014679.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11406 pDONR223 100% 53.9% 53.8% None 808_811delAAAA;814_1500delinsG n/a
2 ccsbBroad304_11406 pLX_304 0% 53.9% 53.8% V5 808_811delAAAA;814_1500delinsG n/a
3 TRCN0000472167 GTGGCTCGCATGTCCTGGGGGTCG pLX_317 60% 53.9% 53.8% V5 808_811delAAAA;814_1500delinsG n/a
Download CSV