Transcript: Human NM_014765.3

Homo sapiens translocase of outer mitochondrial membrane 20 (TOMM20), mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
TOMM20 (9804)
Length:
3283
CDS:
123..560

Additional Resources:

NCBI RefSeq record:
NM_014765.3
NBCI Gene record:
TOMM20 (9804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014765.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149182 CGACTCACATTTGAGGACTTT pLKO.1 2050 3UTR 100% 4.950 3.960 N TOMM20 n/a
2 TRCN0000376458 TTAATCTCTGAGACGTAAATA pLKO_005 1042 3UTR 100% 15.000 10.500 N TOMM20 n/a
3 TRCN0000147061 CCCAGAAATGTAATTGCCAAA pLKO.1 2635 3UTR 100% 4.050 2.835 N TOMM20 n/a
4 TRCN0000364958 TGATCCTTTCTTTCCATTTAA pLKO_005 1025 3UTR 100% 15.000 9.000 N TOMM20 n/a
5 TRCN0000377402 AGCAGTTACTGCAGGTCTTAC pLKO_005 433 CDS 100% 10.800 6.480 N TOMM20 n/a
6 TRCN0000146733 CGAAGAAAGAAACAGAAGCTT pLKO.1 243 CDS 100% 3.000 1.800 N TOMM20 n/a
7 TRCN0000364999 ATATGACATGGCTTATGTTAA pLKO_005 847 3UTR 100% 13.200 6.600 Y TOMM20 n/a
8 TRCN0000369950 GGCGTAGACCATCTGACAAAT pLKO_005 387 CDS 100% 13.200 6.600 Y TOMM20 n/a
9 TRCN0000369983 GTTACTAGCTCAAGGTGAATA pLKO_005 359 CDS 100% 13.200 6.600 Y TOMM20 n/a
10 TRCN0000147757 GAAGAAATACAGCTTGGTGAA pLKO.1 336 CDS 100% 4.050 2.025 Y TOMM20 n/a
11 TRCN0000149946 GCTGTTCAGAAGTTCTTCCTT pLKO.1 315 CDS 100% 3.000 1.500 Y TOMM20 n/a
12 TRCN0000102137 CCCAACTTCAAGAACAGGCTT pLKO.1 216 CDS 100% 2.640 1.320 Y Tomm20 n/a
13 TRCN0000288026 CCCAACTTCAAGAACAGGCTT pLKO_005 216 CDS 100% 2.640 1.320 Y Tomm20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014765.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02247 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02247 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470242 TTCATGAGAAGCGCGTGTGCCCGG pLX_317 98.6% 100% 100% V5 n/a
Download CSV