Transcript: Human NM_014853.3

Homo sapiens small G protein signaling modulator 2 (SGSM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SGSM2 (9905)
Length:
4878
CDS:
189..3344

Additional Resources:

NCBI RefSeq record:
NM_014853.3
NBCI Gene record:
SGSM2 (9905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014853.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151944 CGAGCACATCACTATTAACTA pLKO.1 1469 CDS 100% 5.625 7.875 N SGSM2 n/a
2 TRCN0000155555 CACATCTCATCGGAGCACTTT pLKO.1 3141 CDS 100% 4.950 6.930 N SGSM2 n/a
3 TRCN0000155301 GCAAGTTTACTACGGAGGCAT pLKO.1 2003 CDS 100% 2.640 3.696 N SGSM2 n/a
4 TRCN0000271655 AGCATTCGCTCCGTGGATATG pLKO_005 1383 CDS 100% 10.800 8.640 N SGSM2 n/a
5 TRCN0000155607 CCTTGCGTTCTGCATTAGGTA pLKO.1 4071 3UTR 100% 3.000 2.400 N SGSM2 n/a
6 TRCN0000271657 ACTGCCCTCCTCTCGCAATTA pLKO_005 2441 CDS 100% 13.200 9.240 N SGSM2 n/a
7 TRCN0000271653 TGTGCGGCTGCCTACACTATA pLKO_005 2655 CDS 100% 13.200 9.240 N SGSM2 n/a
8 TRCN0000271604 CCACCTCTGTTCCTAACAAAG pLKO_005 3442 3UTR 100% 10.800 7.560 N SGSM2 n/a
9 TRCN0000093181 CCGTGACAACAACATGGACTT pLKO.1 3209 CDS 100% 4.050 2.835 N Sgsm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014853.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14032 pDONR223 100% 99.6% 16.9% None (many diffs) n/a
2 ccsbBroad304_14032 pLX_304 0% 99.6% 16.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477986 TCTGCATGAAGTGAAGCCCGGGGC pLX_317 9.1% 99.6% 16.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV