Transcript: Human NM_014862.4

Homo sapiens aryl hydrocarbon receptor nuclear translocator 2 (ARNT2), mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
ARNT2 (9915)
Length:
6523
CDS:
135..2288

Additional Resources:

NCBI RefSeq record:
NM_014862.4
NBCI Gene record:
ARNT2 (9915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415648 TGTCGGTCATGTATCGATTTC pLKO_005 1324 CDS 100% 10.800 15.120 N ARNT2 n/a
2 TRCN0000019049 CCTCGGTTTGCTGAAATGTTT pLKO.1 1611 CDS 100% 5.625 7.875 N ARNT2 n/a
3 TRCN0000019051 CAGAGTTCTTATCCCGGCATA pLKO.1 1138 CDS 100% 4.050 3.240 N ARNT2 n/a
4 TRCN0000418730 TGTGGGACAAGGCAGTAAATA pLKO_005 1040 CDS 100% 15.000 10.500 N ARNT2 n/a
5 TRCN0000019050 CAAGAGAGAATCATAGTGAAA pLKO.1 325 CDS 100% 4.950 3.465 N ARNT2 n/a
6 TRCN0000019052 TGAATGATATTCAGTCCTCTT pLKO.1 1774 CDS 100% 4.050 2.835 N ARNT2 n/a
7 TRCN0000019053 CTGAAGCATCTCATCCTTGAA pLKO.1 546 CDS 100% 4.950 2.970 N ARNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014862.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11432 pDONR223 100% 96.7% 95.7% None (many diffs) n/a
2 ccsbBroad304_11432 pLX_304 0% 96.7% 95.7% V5 (many diffs) n/a
3 TRCN0000479506 GTGGTCCAAAGACGCTATTCAGCC pLX_317 13.6% 96.7% 95.7% V5 (many diffs) n/a
Download CSV